FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630767_at:

>probe:Drosophila_2:1630767_at:516:457; Interrogation_Position=1059; Antisense; GATATCCTCGATAACGGCAGGCACT
>probe:Drosophila_2:1630767_at:243:567; Interrogation_Position=1074; Antisense; GGCAGGCACTTCCTTTGGAGTATTC
>probe:Drosophila_2:1630767_at:445:257; Interrogation_Position=1137; Antisense; CACAGCGGTCGGTGGATTGTCTAGT
>probe:Drosophila_2:1630767_at:541:3; Interrogation_Position=1152; Antisense; ATTGTCTAGTGTCCTACTGGCTGGA
>probe:Drosophila_2:1630767_at:481:231; Interrogation_Position=1230; Antisense; AATGCTTCCCGTTTCCGTGAAGGAG
>probe:Drosophila_2:1630767_at:725:559; Interrogation_Position=1261; Antisense; GGAAATGTGACTCTACCCGAAGACC
>probe:Drosophila_2:1630767_at:447:103; Interrogation_Position=1281; Antisense; AGACCCTTGGGTGGATCAGGATCAA
>probe:Drosophila_2:1630767_at:604:651; Interrogation_Position=1302; Antisense; TCAAGTGTTTCCTTTGTACCGTCTA
>probe:Drosophila_2:1630767_at:344:487; Interrogation_Position=1317; Antisense; GTACCGTCTATCTTACCATTGGGTT
>probe:Drosophila_2:1630767_at:314:87; Interrogation_Position=1342; Antisense; AGTCCCATTGGAGTCGTCACAGCAG
>probe:Drosophila_2:1630767_at:681:21; Interrogation_Position=1435; Antisense; ATATCCCCAGTGATCCATAGGTCAG
>probe:Drosophila_2:1630767_at:516:669; Interrogation_Position=885; Antisense; TACGGTTTCAATGGTCTTCCTGGAA
>probe:Drosophila_2:1630767_at:337:393; Interrogation_Position=946; Antisense; GAAAGGCAGTCCACGATTCTGATTA
>probe:Drosophila_2:1630767_at:503:177; Interrogation_Position=971; Antisense; AAACATGCATTATCTTCCAGGGAAT

Paste this into a BLAST search page for me
GATATCCTCGATAACGGCAGGCACTGGCAGGCACTTCCTTTGGAGTATTCCACAGCGGTCGGTGGATTGTCTAGTATTGTCTAGTGTCCTACTGGCTGGAAATGCTTCCCGTTTCCGTGAAGGAGGGAAATGTGACTCTACCCGAAGACCAGACCCTTGGGTGGATCAGGATCAATCAAGTGTTTCCTTTGTACCGTCTAGTACCGTCTATCTTACCATTGGGTTAGTCCCATTGGAGTCGTCACAGCAGATATCCCCAGTGATCCATAGGTCAGTACGGTTTCAATGGTCTTCCTGGAAGAAAGGCAGTCCACGATTCTGATTAAAACATGCATTATCTTCCAGGGAAT

Full Affymetrix probeset data:

Annotations for 1630767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720