Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630771_s_at:

>probe:Drosophila_2:1630771_s_at:103:683; Interrogation_Position=1022; Antisense; TATGCACTACTCTAAAGCGTTCGCG
>probe:Drosophila_2:1630771_s_at:133:719; Interrogation_Position=1041; Antisense; TTCGCGCCCGACTGACTGGAGAATA
>probe:Drosophila_2:1630771_s_at:269:693; Interrogation_Position=1085; Antisense; TTTGTCTCATGTAATCGGTTTTTCC
>probe:Drosophila_2:1630771_s_at:333:477; Interrogation_Position=1102; Antisense; GTTTTTCCATTATCTTCCCGATCGG
>probe:Drosophila_2:1630771_s_at:382:39; Interrogation_Position=1122; Antisense; ATCGGGTTCGAAATCCGGTCGCAGT
>probe:Drosophila_2:1630771_s_at:72:85; Interrogation_Position=1144; Antisense; AGTGTGCGCTCCGAATGCGGCTCAA
>probe:Drosophila_2:1630771_s_at:506:723; Interrogation_Position=1172; Antisense; TTGTTGTTTCCGTTTGAGTCGTTCG
>probe:Drosophila_2:1630771_s_at:2:329; Interrogation_Position=1202; Antisense; GCGTCCTGCTGAATTGGTCCTTAAG
>probe:Drosophila_2:1630771_s_at:65:565; Interrogation_Position=1230; Antisense; GGCACCGGGCTTAAAACAACTCCAG
>probe:Drosophila_2:1630771_s_at:229:109; Interrogation_Position=729; Antisense; AGAAGCTGGCGTCCATCATTTCGGC
>probe:Drosophila_2:1630771_s_at:481:119; Interrogation_Position=822; Antisense; AGCTGCGACGTATTGAGGCCGCCGA
>probe:Drosophila_2:1630771_s_at:474:45; Interrogation_Position=932; Antisense; ATCGCGCAGTAGCTGGGTGCATCTA
>probe:Drosophila_2:1630771_s_at:557:507; Interrogation_Position=948; Antisense; GTGCATCTAGTTCCGTTAAGTTGTA
>probe:Drosophila_2:1630771_s_at:359:489; Interrogation_Position=994; Antisense; GTACTTTTCGATTTTGTTTCTGCTG

Paste this into a BLAST search page for me
TATGCACTACTCTAAAGCGTTCGCGTTCGCGCCCGACTGACTGGAGAATATTTGTCTCATGTAATCGGTTTTTCCGTTTTTCCATTATCTTCCCGATCGGATCGGGTTCGAAATCCGGTCGCAGTAGTGTGCGCTCCGAATGCGGCTCAATTGTTGTTTCCGTTTGAGTCGTTCGGCGTCCTGCTGAATTGGTCCTTAAGGGCACCGGGCTTAAAACAACTCCAGAGAAGCTGGCGTCCATCATTTCGGCAGCTGCGACGTATTGAGGCCGCCGAATCGCGCAGTAGCTGGGTGCATCTAGTGCATCTAGTTCCGTTAAGTTGTAGTACTTTTCGATTTTGTTTCTGCTG

Full Affymetrix probeset data:

Annotations for 1630771_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime