FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630776_at:

>probe:Drosophila_2:1630776_at:21:247; Interrogation_Position=146; Antisense; AATTCAGACCATACCATTTTGCAGG
>probe:Drosophila_2:1630776_at:160:485; Interrogation_Position=184; Antisense; GTATGGCGAAGATCCCAGACAGTCT
>probe:Drosophila_2:1630776_at:26:265; Interrogation_Position=199; Antisense; CAGACAGTCTTTTTGGGTATCCGTA
>probe:Drosophila_2:1630776_at:547:323; Interrogation_Position=225; Antisense; GCGACTACGAGTTGGACAGGGCTTA
>probe:Drosophila_2:1630776_at:245:83; Interrogation_Position=242; Antisense; AGGGCTTACATTGTCTACTGCTTCT
>probe:Drosophila_2:1630776_at:717:667; Interrogation_Position=257; Antisense; TACTGCTTCTTTCTCGATATCGGTG
>probe:Drosophila_2:1630776_at:303:389; Interrogation_Position=304; Antisense; GAAAACCAATCGCATGTACCTGAAG
>probe:Drosophila_2:1630776_at:92:669; Interrogation_Position=329; Antisense; TACTTCAGCGTGGAGGATGCCCGAA
>probe:Drosophila_2:1630776_at:436:635; Interrogation_Position=354; Antisense; TCGCGCTGAGCTACGATGGCCAAAA
>probe:Drosophila_2:1630776_at:624:167; Interrogation_Position=407; Antisense; AAAGTCACAGCTGAGAACCCCGTTT
>probe:Drosophila_2:1630776_at:572:479; Interrogation_Position=428; Antisense; GTTTCCGAGAATGCCGTCAGTGAAT
>probe:Drosophila_2:1630776_at:157:341; Interrogation_Position=512; Antisense; GCTATTGTCGATGCCGCGGATGAAA
>probe:Drosophila_2:1630776_at:541:451; Interrogation_Position=544; Antisense; GATCATTTCCGATCAACTGCTGATG
>probe:Drosophila_2:1630776_at:17:161; Interrogation_Position=666; Antisense; AAATTCCAACATTGCAGCTCTTTTC

Paste this into a BLAST search page for me
AATTCAGACCATACCATTTTGCAGGGTATGGCGAAGATCCCAGACAGTCTCAGACAGTCTTTTTGGGTATCCGTAGCGACTACGAGTTGGACAGGGCTTAAGGGCTTACATTGTCTACTGCTTCTTACTGCTTCTTTCTCGATATCGGTGGAAAACCAATCGCATGTACCTGAAGTACTTCAGCGTGGAGGATGCCCGAATCGCGCTGAGCTACGATGGCCAAAAAAAGTCACAGCTGAGAACCCCGTTTGTTTCCGAGAATGCCGTCAGTGAATGCTATTGTCGATGCCGCGGATGAAAGATCATTTCCGATCAACTGCTGATGAAATTCCAACATTGCAGCTCTTTTC

Full Affymetrix probeset data:

Annotations for 1630776_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720