Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630777_at:

>probe:Drosophila_2:1630777_at:201:9; Interrogation_Position=342; Antisense; ATTGCCTACTTGTTTGTCAGCTGTG
>probe:Drosophila_2:1630777_at:587:127; Interrogation_Position=381; Antisense; ACCAAATCGGTTTGAATTGCCGCCA
>probe:Drosophila_2:1630777_at:387:7; Interrogation_Position=396; Antisense; ATTGCCGCCATATCTAGGTTCTGTA
>probe:Drosophila_2:1630777_at:719:693; Interrogation_Position=431; Antisense; TTTCCCCTTGTTTGCCGATGGTTGA
>probe:Drosophila_2:1630777_at:572:699; Interrogation_Position=463; Antisense; TTTTTCCTTTCAGTCTCCGGAGAAG
>probe:Drosophila_2:1630777_at:461:199; Interrogation_Position=550; Antisense; AACGCAGTGTCCAACGATTCATCAG
>probe:Drosophila_2:1630777_at:107:649; Interrogation_Position=571; Antisense; TCAGCCGCAGCGGTTTCATTTAAAG
>probe:Drosophila_2:1630777_at:381:373; Interrogation_Position=606; Antisense; GAAGTGTGCACCAAATCACCAGGGT
>probe:Drosophila_2:1630777_at:307:13; Interrogation_Position=620; Antisense; ATCACCAGGGTTCTAGCCAAAACTT
>probe:Drosophila_2:1630777_at:59:181; Interrogation_Position=675; Antisense; AAACAGCTGTTTGTGCGATCGCGTG
>probe:Drosophila_2:1630777_at:506:331; Interrogation_Position=711; Antisense; GCGGAGCCCCAGTTCGAGAAACTTA
>probe:Drosophila_2:1630777_at:591:495; Interrogation_Position=800; Antisense; GTCACTATTTGCTATGTGTGCCAGT
>probe:Drosophila_2:1630777_at:572:313; Interrogation_Position=819; Antisense; GCCAGTATTCTGGTCTTGTCCATAA
>probe:Drosophila_2:1630777_at:462:147; Interrogation_Position=869; Antisense; ACTTAATCCACTTTGTCAGGTGCGT

Paste this into a BLAST search page for me
ATTGCCTACTTGTTTGTCAGCTGTGACCAAATCGGTTTGAATTGCCGCCAATTGCCGCCATATCTAGGTTCTGTATTTCCCCTTGTTTGCCGATGGTTGATTTTTCCTTTCAGTCTCCGGAGAAGAACGCAGTGTCCAACGATTCATCAGTCAGCCGCAGCGGTTTCATTTAAAGGAAGTGTGCACCAAATCACCAGGGTATCACCAGGGTTCTAGCCAAAACTTAAACAGCTGTTTGTGCGATCGCGTGGCGGAGCCCCAGTTCGAGAAACTTAGTCACTATTTGCTATGTGTGCCAGTGCCAGTATTCTGGTCTTGTCCATAAACTTAATCCACTTTGTCAGGTGCGT

Full Affymetrix probeset data:

Annotations for 1630777_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime