Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630778_at:

>probe:Drosophila_2:1630778_at:10:693; Interrogation_Position=333; Antisense; TTTGGTGATCGTTCTACACAATCAA
>probe:Drosophila_2:1630778_at:640:637; Interrogation_Position=359; Antisense; TCGATATGCCACTGGATCGCATTCT
>probe:Drosophila_2:1630778_at:215:451; Interrogation_Position=373; Antisense; GATCGCATTCTGGTCGTGGGCTTCG
>probe:Drosophila_2:1630778_at:95:593; Interrogation_Position=449; Antisense; TGGGTCGCCAGTTGTCGCAGATTAC
>probe:Drosophila_2:1630778_at:599:635; Interrogation_Position=463; Antisense; TCGCAGATTACAGCTCTTGATCCTT
>probe:Drosophila_2:1630778_at:332:575; Interrogation_Position=493; Antisense; GGCGCGGAACTAGACCACAAGCTGT
>probe:Drosophila_2:1630778_at:572:541; Interrogation_Position=543; Antisense; GGTTGTGCACACAAATGCCGGAGGA
>probe:Drosophila_2:1630778_at:624:537; Interrogation_Position=589; Antisense; GGTCATGTGGACTACTATCCCAACG
>probe:Drosophila_2:1630778_at:389:141; Interrogation_Position=640; Antisense; ACGGACTCCTGTTCGCACGAGAGAG
>probe:Drosophila_2:1630778_at:640:109; Interrogation_Position=698; Antisense; AGAATGACTTTGTGAGCGCCCGTTG
>probe:Drosophila_2:1630778_at:385:551; Interrogation_Position=732; Antisense; GGAGACTTTAAGTGCCTCCAGCTGC
>probe:Drosophila_2:1630778_at:241:71; Interrogation_Position=810; Antisense; AGGCATCTATTTCCTGGAGACCCGA
>probe:Drosophila_2:1630778_at:358:643; Interrogation_Position=848; Antisense; TCTCCCGTGGAGCATACTTCATAAG
>probe:Drosophila_2:1630778_at:324:343; Interrogation_Position=872; Antisense; GCTTCCTGTAAGCTGCGGATCCAAT

Paste this into a BLAST search page for me
TTTGGTGATCGTTCTACACAATCAATCGATATGCCACTGGATCGCATTCTGATCGCATTCTGGTCGTGGGCTTCGTGGGTCGCCAGTTGTCGCAGATTACTCGCAGATTACAGCTCTTGATCCTTGGCGCGGAACTAGACCACAAGCTGTGGTTGTGCACACAAATGCCGGAGGAGGTCATGTGGACTACTATCCCAACGACGGACTCCTGTTCGCACGAGAGAGAGAATGACTTTGTGAGCGCCCGTTGGGAGACTTTAAGTGCCTCCAGCTGCAGGCATCTATTTCCTGGAGACCCGATCTCCCGTGGAGCATACTTCATAAGGCTTCCTGTAAGCTGCGGATCCAAT

Full Affymetrix probeset data:

Annotations for 1630778_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime