Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630781_at:

>probe:Drosophila_2:1630781_at:474:431; Interrogation_Position=1295; Antisense; GAGTAAACACGGCATGATCTGAAAA
>probe:Drosophila_2:1630781_at:492:475; Interrogation_Position=1351; Antisense; GTTACTGTGAGATTTCGTTCAATTC
>probe:Drosophila_2:1630781_at:27:253; Interrogation_Position=1469; Antisense; CATAAAGTTCCCTCTTGCCAAAGTT
>probe:Drosophila_2:1630781_at:549:443; Interrogation_Position=1508; Antisense; GATGTATCCTGCTAAAAACGCACAA
>probe:Drosophila_2:1630781_at:473:197; Interrogation_Position=1549; Antisense; AATCGTTTTAGGCAAATGTCTCTCA
>probe:Drosophila_2:1630781_at:463:61; Interrogation_Position=1564; Antisense; ATGTCTCTCATTACCTTATGTTCAT
>probe:Drosophila_2:1630781_at:687:695; Interrogation_Position=1652; Antisense; TTTTTTGAAAAACAGCTCACCGAGC
>probe:Drosophila_2:1630781_at:343:339; Interrogation_Position=1666; Antisense; GCTCACCGAGCATTTTTCGTTTAGT
>probe:Drosophila_2:1630781_at:505:697; Interrogation_Position=1685; Antisense; TTTAGTTTCCGCCAGTTGTCAGTTG
>probe:Drosophila_2:1630781_at:490:723; Interrogation_Position=1700; Antisense; TTGTCAGTTGCCTTTTTGGTTCTTT
>probe:Drosophila_2:1630781_at:646:725; Interrogation_Position=1715; Antisense; TTGGTTCTTTTTCCATTCCGACAAT
>probe:Drosophila_2:1630781_at:583:455; Interrogation_Position=1755; Antisense; GATAACACTAGTGCTGAAGTCTAAT
>probe:Drosophila_2:1630781_at:325:481; Interrogation_Position=1796; Antisense; GTTTGTTTTGCTTTATATCTGTTGG
>probe:Drosophila_2:1630781_at:68:521; Interrogation_Position=1820; Antisense; GGGCCTAGCGTTGCCCGAAATCGAA

Paste this into a BLAST search page for me
GAGTAAACACGGCATGATCTGAAAAGTTACTGTGAGATTTCGTTCAATTCCATAAAGTTCCCTCTTGCCAAAGTTGATGTATCCTGCTAAAAACGCACAAAATCGTTTTAGGCAAATGTCTCTCAATGTCTCTCATTACCTTATGTTCATTTTTTTGAAAAACAGCTCACCGAGCGCTCACCGAGCATTTTTCGTTTAGTTTTAGTTTCCGCCAGTTGTCAGTTGTTGTCAGTTGCCTTTTTGGTTCTTTTTGGTTCTTTTTCCATTCCGACAATGATAACACTAGTGCTGAAGTCTAATGTTTGTTTTGCTTTATATCTGTTGGGGGCCTAGCGTTGCCCGAAATCGAA

Full Affymetrix probeset data:

Annotations for 1630781_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime