FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630786_at:

>probe:Drosophila_2:1630786_at:436:427; Interrogation_Position=2478; Antisense; GAGTATCTTTCGTCCTTTAAGGTCG
>probe:Drosophila_2:1630786_at:425:657; Interrogation_Position=2495; Antisense; TAAGGTCGCTTCTTATGCCACTAAG
>probe:Drosophila_2:1630786_at:626:611; Interrogation_Position=2558; Antisense; TGAAAACACTGACCCATTCTACTGG
>probe:Drosophila_2:1630786_at:79:183; Interrogation_Position=2598; Antisense; AAAAGTCAGCCGAAGCTACCAAAGA
>probe:Drosophila_2:1630786_at:347:633; Interrogation_Position=2646; Antisense; TCCCAGGTGGACGTCGAGAGCATCA
>probe:Drosophila_2:1630786_at:717:235; Interrogation_Position=2699; Antisense; AATCGACTACTCCAATCAATATCCC
>probe:Drosophila_2:1630786_at:372:239; Interrogation_Position=2712; Antisense; AATCAATATCCCTCTCCAAATCGAG
>probe:Drosophila_2:1630786_at:22:415; Interrogation_Position=2734; Antisense; GAGCCACCCCAAGCAGTATAGTATT
>probe:Drosophila_2:1630786_at:228:563; Interrogation_Position=2771; Antisense; GGAATAACCGCCATTGGGTACAAAT
>probe:Drosophila_2:1630786_at:569:91; Interrogation_Position=2838; Antisense; AGTTTACTTTTCAAGCTTGCCTAAG
>probe:Drosophila_2:1630786_at:558:275; Interrogation_Position=2853; Antisense; CTTGCCTAAGCGCAGCTATCTTTAA
>probe:Drosophila_2:1630786_at:20:477; Interrogation_Position=2884; Antisense; GTTATTTTGCTCCAAGACTTCACTA
>probe:Drosophila_2:1630786_at:458:489; Interrogation_Position=2932; Antisense; GTACTATTACTTTTTTGTTCGACTG
>probe:Drosophila_2:1630786_at:286:407; Interrogation_Position=2952; Antisense; GACTGTAACAATTTTTCGCCCAGTA

Paste this into a BLAST search page for me
GAGTATCTTTCGTCCTTTAAGGTCGTAAGGTCGCTTCTTATGCCACTAAGTGAAAACACTGACCCATTCTACTGGAAAAGTCAGCCGAAGCTACCAAAGATCCCAGGTGGACGTCGAGAGCATCAAATCGACTACTCCAATCAATATCCCAATCAATATCCCTCTCCAAATCGAGGAGCCACCCCAAGCAGTATAGTATTGGAATAACCGCCATTGGGTACAAATAGTTTACTTTTCAAGCTTGCCTAAGCTTGCCTAAGCGCAGCTATCTTTAAGTTATTTTGCTCCAAGACTTCACTAGTACTATTACTTTTTTGTTCGACTGGACTGTAACAATTTTTCGCCCAGTA

Full Affymetrix probeset data:

Annotations for 1630786_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720