FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630787_at:

>probe:Drosophila_2:1630787_at:370:547; Interrogation_Position=1017; Antisense; GGAGGGCATGTTGCTTTACTCTTAA
>probe:Drosophila_2:1630787_at:35:91; Interrogation_Position=454; Antisense; AGTATGTACGAACTGTGCCTGCTGT
>probe:Drosophila_2:1630787_at:637:463; Interrogation_Position=491; Antisense; GATTCGATCCAAGTAGTCATCCCTC
>probe:Drosophila_2:1630787_at:154:497; Interrogation_Position=506; Antisense; GTCATCCCTCCGTGGTCGTGAAGAT
>probe:Drosophila_2:1630787_at:155:643; Interrogation_Position=541; Antisense; TCTGCCCAGGTGAAGATCCATGCGG
>probe:Drosophila_2:1630787_at:282:381; Interrogation_Position=591; Antisense; GAACGCCGATTCAGCCAGAAGTGGT
>probe:Drosophila_2:1630787_at:27:81; Interrogation_Position=656; Antisense; AGGTGGACATCATGAACTTCAGCAA
>probe:Drosophila_2:1630787_at:586:211; Interrogation_Position=679; Antisense; AAGAACATCGTGAATGCCTCCTTCA
>probe:Drosophila_2:1630787_at:136:269; Interrogation_Position=745; Antisense; CATGTGGTCGAGGTGGCCCAGAACA
>probe:Drosophila_2:1630787_at:264:277; Interrogation_Position=783; Antisense; CTTTATCACATACACCACCGAGAAT
>probe:Drosophila_2:1630787_at:694:93; Interrogation_Position=817; Antisense; AGATTTGCCGTCTTTCCCACAGGAT
>probe:Drosophila_2:1630787_at:343:463; Interrogation_Position=839; Antisense; GATTCGTTTTGGTCCTTCACTCGAC
>probe:Drosophila_2:1630787_at:712:295; Interrogation_Position=860; Antisense; CGACCAGTCACTGCGAGACACGAGA
>probe:Drosophila_2:1630787_at:238:319; Interrogation_Position=903; Antisense; GCCGATCCTGGCCAAACTCAAGAAT

Paste this into a BLAST search page for me
GGAGGGCATGTTGCTTTACTCTTAAAGTATGTACGAACTGTGCCTGCTGTGATTCGATCCAAGTAGTCATCCCTCGTCATCCCTCCGTGGTCGTGAAGATTCTGCCCAGGTGAAGATCCATGCGGGAACGCCGATTCAGCCAGAAGTGGTAGGTGGACATCATGAACTTCAGCAAAAGAACATCGTGAATGCCTCCTTCACATGTGGTCGAGGTGGCCCAGAACACTTTATCACATACACCACCGAGAATAGATTTGCCGTCTTTCCCACAGGATGATTCGTTTTGGTCCTTCACTCGACCGACCAGTCACTGCGAGACACGAGAGCCGATCCTGGCCAAACTCAAGAAT

Full Affymetrix probeset data:

Annotations for 1630787_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720