Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630788_at:

>probe:Drosophila_2:1630788_at:488:349; Interrogation_Position=1073; Antisense; GCAGTGGGCACAAAGCGCTACGATT
>probe:Drosophila_2:1630788_at:77:341; Interrogation_Position=1089; Antisense; GCTACGATTCAAATTCTGGTGGCGA
>probe:Drosophila_2:1630788_at:77:327; Interrogation_Position=1110; Antisense; GCGAGCGGGAGATTCAGCGTACTAT
>probe:Drosophila_2:1630788_at:160:265; Interrogation_Position=1151; Antisense; CAGTTGGATGGTTTCGATTCGCGCG
>probe:Drosophila_2:1630788_at:232:237; Interrogation_Position=1202; Antisense; AATCGTATCGAGACCCTTGACCCGG
>probe:Drosophila_2:1630788_at:197:57; Interrogation_Position=1278; Antisense; ATGAGAAGACCAAGCGCCGCATCTT
>probe:Drosophila_2:1630788_at:184:55; Interrogation_Position=1322; Antisense; ATGACGCTGGCCGAGGACGTGAACC
>probe:Drosophila_2:1630788_at:367:555; Interrogation_Position=1336; Antisense; GGACGTGAACCTTAGCGAACTGATC
>probe:Drosophila_2:1630788_at:50:169; Interrogation_Position=1366; Antisense; AAAGGACGATCTATCCGGCGCCGAC
>probe:Drosophila_2:1630788_at:525:307; Interrogation_Position=1398; Antisense; CCATCTGTACAGAGGCTGGCTTGAT
>probe:Drosophila_2:1630788_at:597:525; Interrogation_Position=1431; Antisense; GGGAACGCCGCATGAAGGTGACCAA
>probe:Drosophila_2:1630788_at:707:255; Interrogation_Position=1473; Antisense; CAAAGGAGAGCGTCTTGTACCGGAA
>probe:Drosophila_2:1630788_at:667:351; Interrogation_Position=1506; Antisense; GCACGCCCGAGGGTCTTTATTTATA
>probe:Drosophila_2:1630788_at:344:13; Interrogation_Position=1594; Antisense; ATTAACACTAGAATCGCTCCCCGAT

Paste this into a BLAST search page for me
GCAGTGGGCACAAAGCGCTACGATTGCTACGATTCAAATTCTGGTGGCGAGCGAGCGGGAGATTCAGCGTACTATCAGTTGGATGGTTTCGATTCGCGCGAATCGTATCGAGACCCTTGACCCGGATGAGAAGACCAAGCGCCGCATCTTATGACGCTGGCCGAGGACGTGAACCGGACGTGAACCTTAGCGAACTGATCAAAGGACGATCTATCCGGCGCCGACCCATCTGTACAGAGGCTGGCTTGATGGGAACGCCGCATGAAGGTGACCAACAAAGGAGAGCGTCTTGTACCGGAAGCACGCCCGAGGGTCTTTATTTATAATTAACACTAGAATCGCTCCCCGAT

Full Affymetrix probeset data:

Annotations for 1630788_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime