FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630789_at:

>probe:Drosophila_2:1630789_at:419:211; Interrogation_Position=1007; Antisense; AAGACAATAGCTGCTCCTACGATCG
>probe:Drosophila_2:1630789_at:674:449; Interrogation_Position=1027; Antisense; GATCGCTGCGCCAATAGGAACCAAC
>probe:Drosophila_2:1630789_at:397:157; Interrogation_Position=1070; Antisense; ACACGGGCTGCAGGGAGTTCACGAT
>probe:Drosophila_2:1630789_at:600:515; Interrogation_Position=1128; Antisense; GTGTCCGGAGGACTATCCATATTTC
>probe:Drosophila_2:1630789_at:213:609; Interrogation_Position=1155; Antisense; TGAGCTATTGCGACAGTGCACCGAT
>probe:Drosophila_2:1630789_at:308:595; Interrogation_Position=656; Antisense; TGGGCGATCCCAAGAGCTGTCAAAT
>probe:Drosophila_2:1630789_at:137:729; Interrogation_Position=704; Antisense; TTGGCACCATGTTGAATTGCTCCGT
>probe:Drosophila_2:1630789_at:346:247; Interrogation_Position=718; Antisense; AATTGCTCCGTTGGGCGATACTTTA
>probe:Drosophila_2:1630789_at:163:493; Interrogation_Position=755; Antisense; GTAATTGCCAATCCTGGATGCCGCA
>probe:Drosophila_2:1630789_at:680:447; Interrogation_Position=771; Antisense; GATGCCGCATTACTGTTCCAAGGAT
>probe:Drosophila_2:1630789_at:74:555; Interrogation_Position=828; Antisense; GGACCATAATATCTGCTCCAAGTAT
>probe:Drosophila_2:1630789_at:610:99; Interrogation_Position=867; Antisense; AGATGGAGTGCAACTCCTGCCGGAT
>probe:Drosophila_2:1630789_at:245:305; Interrogation_Position=886; Antisense; CCGGATCTGATGACCTGTTACGGAT
>probe:Drosophila_2:1630789_at:463:475; Interrogation_Position=902; Antisense; GTTACGGATATTACTCCTGCACATC

Paste this into a BLAST search page for me
AAGACAATAGCTGCTCCTACGATCGGATCGCTGCGCCAATAGGAACCAACACACGGGCTGCAGGGAGTTCACGATGTGTCCGGAGGACTATCCATATTTCTGAGCTATTGCGACAGTGCACCGATTGGGCGATCCCAAGAGCTGTCAAATTTGGCACCATGTTGAATTGCTCCGTAATTGCTCCGTTGGGCGATACTTTAGTAATTGCCAATCCTGGATGCCGCAGATGCCGCATTACTGTTCCAAGGATGGACCATAATATCTGCTCCAAGTATAGATGGAGTGCAACTCCTGCCGGATCCGGATCTGATGACCTGTTACGGATGTTACGGATATTACTCCTGCACATC

Full Affymetrix probeset data:

Annotations for 1630789_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720