FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630792_at:

>probe:Drosophila_2:1630792_at:83:29; Interrogation_Position=1203; Antisense; ATACCCATTGATCTACTCGATCGCA
>probe:Drosophila_2:1630792_at:83:271; Interrogation_Position=1226; Antisense; CATGATCATCATACGCACTGTACCG
>probe:Drosophila_2:1630792_at:246:355; Interrogation_Position=1240; Antisense; GCACTGTACCGTATTCCGAGAAGGA
>probe:Drosophila_2:1630792_at:272:551; Interrogation_Position=1271; Antisense; GGAGATCCTAAAGATTCGCTGCGAG
>probe:Drosophila_2:1630792_at:405:549; Interrogation_Position=1298; Antisense; GGAGGACTGCATCATGCACCCGGAT
>probe:Drosophila_2:1630792_at:501:11; Interrogation_Position=1332; Antisense; ATTCTTACACGCATCGCCACAGATA
>probe:Drosophila_2:1630792_at:333:155; Interrogation_Position=1350; Antisense; ACAGATACCAGTTTACGCTACGCCA
>probe:Drosophila_2:1630792_at:634:461; Interrogation_Position=1382; Antisense; GATTACCACAGCCAACTTGGTCTGT
>probe:Drosophila_2:1630792_at:19:227; Interrogation_Position=1416; Antisense; AAGGCCACCGAAGTCAATACCGAGG
>probe:Drosophila_2:1630792_at:17:211; Interrogation_Position=1446; Antisense; AAGAAGGTCTACTCGCTCTTCCTGG
>probe:Drosophila_2:1630792_at:666:367; Interrogation_Position=1475; Antisense; GAATCGCTCGAGCAAGATCCTCAAG
>probe:Drosophila_2:1630792_at:73:547; Interrogation_Position=1508; Antisense; GGATGACTACATGTTCAGCGAGATC
>probe:Drosophila_2:1630792_at:313:437; Interrogation_Position=1597; Antisense; GAGGAGATGCCCAGCCCATGGAGCA
>probe:Drosophila_2:1630792_at:175:167; Interrogation_Position=1717; Antisense; AAATGCCTACGAATTTGGTCATGGT

Paste this into a BLAST search page for me
ATACCCATTGATCTACTCGATCGCACATGATCATCATACGCACTGTACCGGCACTGTACCGTATTCCGAGAAGGAGGAGATCCTAAAGATTCGCTGCGAGGGAGGACTGCATCATGCACCCGGATATTCTTACACGCATCGCCACAGATAACAGATACCAGTTTACGCTACGCCAGATTACCACAGCCAACTTGGTCTGTAAGGCCACCGAAGTCAATACCGAGGAAGAAGGTCTACTCGCTCTTCCTGGGAATCGCTCGAGCAAGATCCTCAAGGGATGACTACATGTTCAGCGAGATCGAGGAGATGCCCAGCCCATGGAGCAAAATGCCTACGAATTTGGTCATGGT

Full Affymetrix probeset data:

Annotations for 1630792_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720