FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630794_at:

>probe:Drosophila_2:1630794_at:683:231; Interrogation_Position=3375; Antisense; AATGAACTTGTTGCAGCGTCTGATA
>probe:Drosophila_2:1630794_at:720:653; Interrogation_Position=3398; Antisense; TAATCAAGCAGGTCTGGCGGCAAAA
>probe:Drosophila_2:1630794_at:710:391; Interrogation_Position=3462; Antisense; GAAACCGCAGTCAATGCCGATCCTG
>probe:Drosophila_2:1630794_at:215:87; Interrogation_Position=3527; Antisense; AGTGCCCCGATTTAAGGCCAGCATT
>probe:Drosophila_2:1630794_at:325:69; Interrogation_Position=3541; Antisense; AGGCCAGCATTGTCGGAATACGCGG
>probe:Drosophila_2:1630794_at:672:75; Interrogation_Position=3611; Antisense; AGGTTCTGGACATCATCTCCGGGAA
>probe:Drosophila_2:1630794_at:691:35; Interrogation_Position=3636; Antisense; ATCAGTTGATGTGTTCGTGACGGAC
>probe:Drosophila_2:1630794_at:177:573; Interrogation_Position=3667; Antisense; GGCGGTTACATCAGTGCCGAGCATA
>probe:Drosophila_2:1630794_at:675:99; Interrogation_Position=3699; Antisense; AGAGGCACCGGATCCATCAGAAATT
>probe:Drosophila_2:1630794_at:328:15; Interrogation_Position=3721; Antisense; ATTAGTGTCATTTCCACAGTGCCCG
>probe:Drosophila_2:1630794_at:595:85; Interrogation_Position=3738; Antisense; AGTGCCCGTACTGACGTCTCTAGTA
>probe:Drosophila_2:1630794_at:417:679; Interrogation_Position=3785; Antisense; TAGGCAGTGATCTTAACCAGCCCCT
>probe:Drosophila_2:1630794_at:182:179; Interrogation_Position=3901; Antisense; AAACTCACTGTTCTAGGCGATAATA
>probe:Drosophila_2:1630794_at:131:413; Interrogation_Position=3943; Antisense; GACCGCACCCACATACATTATAAAG

Paste this into a BLAST search page for me
AATGAACTTGTTGCAGCGTCTGATATAATCAAGCAGGTCTGGCGGCAAAAGAAACCGCAGTCAATGCCGATCCTGAGTGCCCCGATTTAAGGCCAGCATTAGGCCAGCATTGTCGGAATACGCGGAGGTTCTGGACATCATCTCCGGGAAATCAGTTGATGTGTTCGTGACGGACGGCGGTTACATCAGTGCCGAGCATAAGAGGCACCGGATCCATCAGAAATTATTAGTGTCATTTCCACAGTGCCCGAGTGCCCGTACTGACGTCTCTAGTATAGGCAGTGATCTTAACCAGCCCCTAAACTCACTGTTCTAGGCGATAATAGACCGCACCCACATACATTATAAAG

Full Affymetrix probeset data:

Annotations for 1630794_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720