Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630795_at:

>probe:Drosophila_2:1630795_at:233:167; Interrogation_Position=2197; Antisense; AAATCCACGCATCGTCATTGTATGA
>probe:Drosophila_2:1630795_at:603:363; Interrogation_Position=2220; Antisense; GAATAAGCTGCATTTAAGTCACCAA
>probe:Drosophila_2:1630795_at:566:337; Interrogation_Position=2276; Antisense; GCTCCGAGCGAGAATCCAGCTGAAA
>probe:Drosophila_2:1630795_at:394:335; Interrogation_Position=2294; Antisense; GCTGAAATACCTCCGATTGCATGGG
>probe:Drosophila_2:1630795_at:506:83; Interrogation_Position=2322; Antisense; AGTGGATCCAGGTGACAGACGCGCT
>probe:Drosophila_2:1630795_at:589:323; Interrogation_Position=2342; Antisense; GCGCTGCATACCCTGTTATACTATG
>probe:Drosophila_2:1630795_at:647:513; Interrogation_Position=2374; Antisense; GTGATACATTTAGTACACACACTCA
>probe:Drosophila_2:1630795_at:382:491; Interrogation_Position=2386; Antisense; GTACACACACTCAAATAACCACGCA
>probe:Drosophila_2:1630795_at:122:661; Interrogation_Position=2401; Antisense; TAACCACGCACAAACTATACTAAAT
>probe:Drosophila_2:1630795_at:47:413; Interrogation_Position=2465; Antisense; GACCATTGAAAGGAGTTGGCTGTTT
>probe:Drosophila_2:1630795_at:628:333; Interrogation_Position=2483; Antisense; GCTGTTTTGTTGTTTAAATCCTACT
>probe:Drosophila_2:1630795_at:364:401; Interrogation_Position=2556; Antisense; GACATGTACTCTTAATGTTTCGATA
>probe:Drosophila_2:1630795_at:600:709; Interrogation_Position=2631; Antisense; TTCAGTTTTCCGACTAACGACCAAT
>probe:Drosophila_2:1630795_at:545:137; Interrogation_Position=2647; Antisense; ACGACCAATTGTTTTTTCCAGTGAT

Paste this into a BLAST search page for me
AAATCCACGCATCGTCATTGTATGAGAATAAGCTGCATTTAAGTCACCAAGCTCCGAGCGAGAATCCAGCTGAAAGCTGAAATACCTCCGATTGCATGGGAGTGGATCCAGGTGACAGACGCGCTGCGCTGCATACCCTGTTATACTATGGTGATACATTTAGTACACACACTCAGTACACACACTCAAATAACCACGCATAACCACGCACAAACTATACTAAATGACCATTGAAAGGAGTTGGCTGTTTGCTGTTTTGTTGTTTAAATCCTACTGACATGTACTCTTAATGTTTCGATATTCAGTTTTCCGACTAACGACCAATACGACCAATTGTTTTTTCCAGTGAT

Full Affymetrix probeset data:

Annotations for 1630795_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime