FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630797_at:

>probe:Drosophila_2:1630797_at:180:611; Interrogation_Position=156; Antisense; TAGACGAATATTGCGGGCGTCCCGC
>probe:Drosophila_2:1630797_at:326:689; Interrogation_Position=188; Antisense; TTTGCGGTAGTCTTCGAACGGGCGA
>probe:Drosophila_2:1630797_at:405:629; Interrogation_Position=217; Antisense; TCCAGCACCTCAGCAAGTTGTCGAA
>probe:Drosophila_2:1630797_at:646:31; Interrogation_Position=251; Antisense; ATAATCATTTTTGTCCTGCAGGCAC
>probe:Drosophila_2:1630797_at:458:183; Interrogation_Position=305; Antisense; AAAAGCGATGTCACTCTCTACCATG
>probe:Drosophila_2:1630797_at:111:421; Interrogation_Position=329; Antisense; GAGCAATCCCTTGAGGACTTCTGAA
>probe:Drosophila_2:1630797_at:14:175; Interrogation_Position=379; Antisense; AAACCCAGCTGGATTGTCCGAATTT
>probe:Drosophila_2:1630797_at:638:363; Interrogation_Position=398; Antisense; GAATTTGACCAGTGCTCGATGCTTT
>probe:Drosophila_2:1630797_at:53:447; Interrogation_Position=415; Antisense; GATGCTTTGGCCGTTCGCAGTCTGC
>probe:Drosophila_2:1630797_at:207:549; Interrogation_Position=494; Antisense; GGAGAGGATCCGTCGCTAACAGAAT
>probe:Drosophila_2:1630797_at:711:665; Interrogation_Position=526; Antisense; TACAGACGTTCTTACGACTCGGTTT
>probe:Drosophila_2:1630797_at:456:671; Interrogation_Position=538; Antisense; TACGACTCGGTTTTGGGATCTAGGA
>probe:Drosophila_2:1630797_at:322:331; Interrogation_Position=588; Antisense; GCGGACTCTGAGCTTTGTCAATCAT
>probe:Drosophila_2:1630797_at:293:693; Interrogation_Position=658; Antisense; TTTCTTCGTTTTCATGTTTACCTAG

Paste this into a BLAST search page for me
TAGACGAATATTGCGGGCGTCCCGCTTTGCGGTAGTCTTCGAACGGGCGATCCAGCACCTCAGCAAGTTGTCGAAATAATCATTTTTGTCCTGCAGGCACAAAAGCGATGTCACTCTCTACCATGGAGCAATCCCTTGAGGACTTCTGAAAAACCCAGCTGGATTGTCCGAATTTGAATTTGACCAGTGCTCGATGCTTTGATGCTTTGGCCGTTCGCAGTCTGCGGAGAGGATCCGTCGCTAACAGAATTACAGACGTTCTTACGACTCGGTTTTACGACTCGGTTTTGGGATCTAGGAGCGGACTCTGAGCTTTGTCAATCATTTTCTTCGTTTTCATGTTTACCTAG

Full Affymetrix probeset data:

Annotations for 1630797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720