FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630798_at:

>probe:Drosophila_2:1630798_at:197:665; Interrogation_Position=125; Antisense; TAAATGTGGGCGTGGCTCAGGCCTA
>probe:Drosophila_2:1630798_at:89:71; Interrogation_Position=143; Antisense; AGGCCTACCTGAACCAGAAGCGGCT
>probe:Drosophila_2:1630798_at:195:357; Interrogation_Position=178; Antisense; GCAAAGCAACTGCACTTGGGCGCCA
>probe:Drosophila_2:1630798_at:129:229; Interrogation_Position=227; Antisense; AATGGCTGCAGCTCATCGACCAATT
>probe:Drosophila_2:1630798_at:491:413; Interrogation_Position=244; Antisense; GACCAATTCAGCACTGCCCTAAAGG
>probe:Drosophila_2:1630798_at:573:623; Interrogation_Position=258; Antisense; TGCCCTAAAGGATCTCGGCGACGTG
>probe:Drosophila_2:1630798_at:557:269; Interrogation_Position=312; Antisense; CATGCATACGATTAACCAGACCCTA
>probe:Drosophila_2:1630798_at:616:103; Interrogation_Position=329; Antisense; AGACCCTAGAGCTGGCCTACAAAGC
>probe:Drosophila_2:1630798_at:393:175; Interrogation_Position=349; Antisense; AAAGCCTCTCGAGCGACACAGACAT
>probe:Drosophila_2:1630798_at:712:103; Interrogation_Position=368; Antisense; AGACATCGAGCGGAGCAGGTACATC
>probe:Drosophila_2:1630798_at:262:643; Interrogation_Position=403; Antisense; TCTACTTCAGCGTCGGCAAGTGCAA
>probe:Drosophila_2:1630798_at:311:361; Interrogation_Position=418; Antisense; GCAAGTGCAAATCCCAGTGCTACTT
>probe:Drosophila_2:1630798_at:264:109; Interrogation_Position=84; Antisense; AGAAGCGTCCAATGAGCTCACTCAG
>probe:Drosophila_2:1630798_at:101:419; Interrogation_Position=97; Antisense; GAGCTCACTCAGTCTCTGGTGGACA

Paste this into a BLAST search page for me
TAAATGTGGGCGTGGCTCAGGCCTAAGGCCTACCTGAACCAGAAGCGGCTGCAAAGCAACTGCACTTGGGCGCCAAATGGCTGCAGCTCATCGACCAATTGACCAATTCAGCACTGCCCTAAAGGTGCCCTAAAGGATCTCGGCGACGTGCATGCATACGATTAACCAGACCCTAAGACCCTAGAGCTGGCCTACAAAGCAAAGCCTCTCGAGCGACACAGACATAGACATCGAGCGGAGCAGGTACATCTCTACTTCAGCGTCGGCAAGTGCAAGCAAGTGCAAATCCCAGTGCTACTTAGAAGCGTCCAATGAGCTCACTCAGGAGCTCACTCAGTCTCTGGTGGACA

Full Affymetrix probeset data:

Annotations for 1630798_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720