Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630800_s_at:

>probe:Drosophila_2:1630800_s_at:22:447; Interrogation_Position=193; Antisense; GATGCAACAACGTCGCAGCCAAAAG
>probe:Drosophila_2:1630800_s_at:134:155; Interrogation_Position=254; Antisense; ACAGTGTGCTGAATCTCCCGGGCTA
>probe:Drosophila_2:1630800_s_at:119:305; Interrogation_Position=271; Antisense; CCGGGCTACTAACGGCTGTACAATG
>probe:Drosophila_2:1630800_s_at:66:63; Interrogation_Position=293; Antisense; ATGTCCTATTGCTAGATCTGGCAGA
>probe:Drosophila_2:1630800_s_at:206:373; Interrogation_Position=316; Antisense; GAAGTTTTTGCTATGCCAGTTTGGT
>probe:Drosophila_2:1630800_s_at:572:619; Interrogation_Position=363; Antisense; TGCTCCCTGACTCTTTCAGATCAAG
>probe:Drosophila_2:1630800_s_at:243:49; Interrogation_Position=392; Antisense; ATGCCTGGCTGATCCAAATTGCCAC
>probe:Drosophila_2:1630800_s_at:510:161; Interrogation_Position=407; Antisense; AAATTGCCACTTGTGCGATCCTTTG
>probe:Drosophila_2:1630800_s_at:247:447; Interrogation_Position=423; Antisense; GATCCTTTGGAACAACCACACTGCA
>probe:Drosophila_2:1630800_s_at:643:79; Interrogation_Position=462; Antisense; AGGGCAGATGATTCACCAACCACCA
>probe:Drosophila_2:1630800_s_at:539:587; Interrogation_Position=52; Antisense; TGGATGCCTGCGTTAGTGTTTTTAA
>probe:Drosophila_2:1630800_s_at:125:433; Interrogation_Position=522; Antisense; GAGTCCACGCCTAGTTCAACAATGA
>probe:Drosophila_2:1630800_s_at:486:657; Interrogation_Position=74; Antisense; TAAGGCAGGCGTAATTCAGGCCCAA
>probe:Drosophila_2:1630800_s_at:301:7; Interrogation_Position=87; Antisense; ATTCAGGCCCAAGGATGTCTGGAAA

Paste this into a BLAST search page for me
GATGCAACAACGTCGCAGCCAAAAGACAGTGTGCTGAATCTCCCGGGCTACCGGGCTACTAACGGCTGTACAATGATGTCCTATTGCTAGATCTGGCAGAGAAGTTTTTGCTATGCCAGTTTGGTTGCTCCCTGACTCTTTCAGATCAAGATGCCTGGCTGATCCAAATTGCCACAAATTGCCACTTGTGCGATCCTTTGGATCCTTTGGAACAACCACACTGCAAGGGCAGATGATTCACCAACCACCATGGATGCCTGCGTTAGTGTTTTTAAGAGTCCACGCCTAGTTCAACAATGATAAGGCAGGCGTAATTCAGGCCCAAATTCAGGCCCAAGGATGTCTGGAAA

Full Affymetrix probeset data:

Annotations for 1630800_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime