FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630801_at:

>probe:Drosophila_2:1630801_at:514:191; Interrogation_Position=1861; Antisense; AACTAGTTTACTGAGCTGCACATCC
>probe:Drosophila_2:1630801_at:671:417; Interrogation_Position=1873; Antisense; GAGCTGCACATCCTTATTTATTTAT
>probe:Drosophila_2:1630801_at:136:29; Interrogation_Position=1907; Antisense; ATACGACTGACTACTTAAACTGGAT
>probe:Drosophila_2:1630801_at:272:709; Interrogation_Position=1932; Antisense; TTAAAAGTTCAAAGAGCCCGGCGAT
>probe:Drosophila_2:1630801_at:647:171; Interrogation_Position=1942; Antisense; AAAGAGCCCGGCGATATTGGTCCTA
>probe:Drosophila_2:1630801_at:413:3; Interrogation_Position=1957; Antisense; ATTGGTCCTAGCTCATATACTTTGT
>probe:Drosophila_2:1630801_at:430:205; Interrogation_Position=1997; Antisense; AAGCCCATTTTCAAGCACTTTTTGT
>probe:Drosophila_2:1630801_at:242:383; Interrogation_Position=2117; Antisense; GAACGTGTATGTGCGCGAATGTAAT
>probe:Drosophila_2:1630801_at:691:345; Interrogation_Position=2163; Antisense; GCATTTGTGGTCTTTGTTTCGTGTC
>probe:Drosophila_2:1630801_at:286:695; Interrogation_Position=2179; Antisense; TTTCGTGTCCTGTGTCCAAGTCCAA
>probe:Drosophila_2:1630801_at:171:267; Interrogation_Position=2223; Antisense; CAGTCAAGTCTGCATAAAGCGTATT
>probe:Drosophila_2:1630801_at:10:661; Interrogation_Position=2254; Antisense; TAAGCCAGCATACCATACTACACGA
>probe:Drosophila_2:1630801_at:483:167; Interrogation_Position=2278; Antisense; AAAGCTAAGTGTCATTCCTCCAACG
>probe:Drosophila_2:1630801_at:155:515; Interrogation_Position=2286; Antisense; GTGTCATTCCTCCAACGATTAATTC

Paste this into a BLAST search page for me
AACTAGTTTACTGAGCTGCACATCCGAGCTGCACATCCTTATTTATTTATATACGACTGACTACTTAAACTGGATTTAAAAGTTCAAAGAGCCCGGCGATAAAGAGCCCGGCGATATTGGTCCTAATTGGTCCTAGCTCATATACTTTGTAAGCCCATTTTCAAGCACTTTTTGTGAACGTGTATGTGCGCGAATGTAATGCATTTGTGGTCTTTGTTTCGTGTCTTTCGTGTCCTGTGTCCAAGTCCAACAGTCAAGTCTGCATAAAGCGTATTTAAGCCAGCATACCATACTACACGAAAAGCTAAGTGTCATTCCTCCAACGGTGTCATTCCTCCAACGATTAATTC

Full Affymetrix probeset data:

Annotations for 1630801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720