FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630803_at:

>probe:Drosophila_2:1630803_at:685:245; Interrogation_Position=211; Antisense; AATTCGATAACTAGCATCTCCCATC
>probe:Drosophila_2:1630803_at:575:147; Interrogation_Position=268; Antisense; ACACTTTTTTCGATGGTGGGCTCCA
>probe:Drosophila_2:1630803_at:150:533; Interrogation_Position=282; Antisense; GGTGGGCTCCAATTTCGGAATTATT
>probe:Drosophila_2:1630803_at:535:701; Interrogation_Position=302; Antisense; TTATTTACCACAACAGCGCCGGTGG
>probe:Drosophila_2:1630803_at:499:531; Interrogation_Position=322; Antisense; GGTGGCGCAAGCAGTCATGGACAAT
>probe:Drosophila_2:1630803_at:503:449; Interrogation_Position=370; Antisense; GATCGGGATAGGACCACACCATCTT
>probe:Drosophila_2:1630803_at:603:5; Interrogation_Position=438; Antisense; ATTGATTCCGGATGCGGTCACCTCG
>probe:Drosophila_2:1630803_at:65:263; Interrogation_Position=474; Antisense; CATGGGAGGCTTTCAGTCGGACGAC
>probe:Drosophila_2:1630803_at:305:675; Interrogation_Position=524; Antisense; TAGCCGCCCAGAAGTACATGTCCGA
>probe:Drosophila_2:1630803_at:171:683; Interrogation_Position=591; Antisense; TATGCAAACCACCAATACACCGGGA
>probe:Drosophila_2:1630803_at:694:369; Interrogation_Position=621; Antisense; GAAGGCCAAGGACCGCAAGTTCACC
>probe:Drosophila_2:1630803_at:553:249; Interrogation_Position=636; Antisense; CAAGTTCACCTTGACCATGGAGGAT
>probe:Drosophila_2:1630803_at:382:269; Interrogation_Position=651; Antisense; CATGGAGGATCTGCAGCCGGCTTTG
>probe:Drosophila_2:1630803_at:400:571; Interrogation_Position=669; Antisense; GGCTTTGGCCGACTACGGTATTAAT

Paste this into a BLAST search page for me
AATTCGATAACTAGCATCTCCCATCACACTTTTTTCGATGGTGGGCTCCAGGTGGGCTCCAATTTCGGAATTATTTTATTTACCACAACAGCGCCGGTGGGGTGGCGCAAGCAGTCATGGACAATGATCGGGATAGGACCACACCATCTTATTGATTCCGGATGCGGTCACCTCGCATGGGAGGCTTTCAGTCGGACGACTAGCCGCCCAGAAGTACATGTCCGATATGCAAACCACCAATACACCGGGAGAAGGCCAAGGACCGCAAGTTCACCCAAGTTCACCTTGACCATGGAGGATCATGGAGGATCTGCAGCCGGCTTTGGGCTTTGGCCGACTACGGTATTAAT

Full Affymetrix probeset data:

Annotations for 1630803_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720