Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630804_at:

>probe:Drosophila_2:1630804_at:605:13; Interrogation_Position=2190; Antisense; ATTCAACGCAGAGATGCCGCTCCAG
>probe:Drosophila_2:1630804_at:243:101; Interrogation_Position=2225; Antisense; AGAGACAGCGGTATTCAGGAATCCC
>probe:Drosophila_2:1630804_at:277:73; Interrogation_Position=2241; Antisense; AGGAATCCCAGTTCGGTGACTACTT
>probe:Drosophila_2:1630804_at:93:529; Interrogation_Position=2255; Antisense; GGTGACTACTTCATCGGGTGGAGCA
>probe:Drosophila_2:1630804_at:112:531; Interrogation_Position=2308; Antisense; GGGTCACCTATGCACAAGTGGTCTT
>probe:Drosophila_2:1630804_at:665:221; Interrogation_Position=2323; Antisense; AAGTGGTCTTTCCACCAGACAGACG
>probe:Drosophila_2:1630804_at:445:443; Interrogation_Position=2355; Antisense; GATGATGGTAGCACCAGTCCCAAGC
>probe:Drosophila_2:1630804_at:118:123; Interrogation_Position=2393; Antisense; AGCGAACGTACCATTGCATCTGCTC
>probe:Drosophila_2:1630804_at:135:719; Interrogation_Position=2431; Antisense; TTCGCAGCCAGTTGGGCAACCTGAA
>probe:Drosophila_2:1630804_at:29:677; Interrogation_Position=2494; Antisense; TAGACACTGTAGACACCGACGATGT
>probe:Drosophila_2:1630804_at:189:441; Interrogation_Position=2514; Antisense; GATGTGGTGGTCACCCAACCGCAGG
>probe:Drosophila_2:1630804_at:297:597; Interrogation_Position=2546; Antisense; TGTGCTTCCGATAACCAGAGACCTT
>probe:Drosophila_2:1630804_at:529:33; Interrogation_Position=2581; Antisense; ATCAACCGCAACCTGAGAGTCCGAG
>probe:Drosophila_2:1630804_at:366:213; Interrogation_Position=2684; Antisense; AAGATCGATCCAATGTGCCAAGACA

Paste this into a BLAST search page for me
ATTCAACGCAGAGATGCCGCTCCAGAGAGACAGCGGTATTCAGGAATCCCAGGAATCCCAGTTCGGTGACTACTTGGTGACTACTTCATCGGGTGGAGCAGGGTCACCTATGCACAAGTGGTCTTAAGTGGTCTTTCCACCAGACAGACGGATGATGGTAGCACCAGTCCCAAGCAGCGAACGTACCATTGCATCTGCTCTTCGCAGCCAGTTGGGCAACCTGAATAGACACTGTAGACACCGACGATGTGATGTGGTGGTCACCCAACCGCAGGTGTGCTTCCGATAACCAGAGACCTTATCAACCGCAACCTGAGAGTCCGAGAAGATCGATCCAATGTGCCAAGACA

Full Affymetrix probeset data:

Annotations for 1630804_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime