FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630805_at:

>probe:Drosophila_2:1630805_at:404:149; Interrogation_Position=1289; Antisense; ACTTGCCGCTCGGATGGGACGGTAA
>probe:Drosophila_2:1630805_at:93:663; Interrogation_Position=1311; Antisense; TAAACCTATCCCCTACTGGTTGTAT
>probe:Drosophila_2:1630805_at:69:541; Interrogation_Position=1328; Antisense; GGTTGTATAAACTGCATGGCCTGAA
>probe:Drosophila_2:1630805_at:556:583; Interrogation_Position=1377; Antisense; TGGAAACTTCACCTACAAGGGTCCT
>probe:Drosophila_2:1630805_at:641:501; Interrogation_Position=1397; Antisense; GTCCTAAGGCTTTTCAACGACACTT
>probe:Drosophila_2:1630805_at:336:231; Interrogation_Position=1486; Antisense; AATGTCACCCAGATCGAGGACGCAA
>probe:Drosophila_2:1630805_at:13:437; Interrogation_Position=1501; Antisense; GAGGACGCAATCACGTTGTGGGAAA
>probe:Drosophila_2:1630805_at:403:133; Interrogation_Position=1586; Antisense; ACTCGCTGGGAAACGTTGTCAACCG
>probe:Drosophila_2:1630805_at:187:451; Interrogation_Position=1624; Antisense; GATCTAAAACGCCAGGGTCTACTTT
>probe:Drosophila_2:1630805_at:276:559; Interrogation_Position=1652; Antisense; GGACAAGCCTACGATTATGGTCGCT
>probe:Drosophila_2:1630805_at:663:645; Interrogation_Position=1667; Antisense; TATGGTCGCTTGAGTACCGGTCAAT
>probe:Drosophila_2:1630805_at:227:657; Interrogation_Position=1694; Antisense; TATATGACGCTTCCTCTAAAACCTC
>probe:Drosophila_2:1630805_at:660:201; Interrogation_Position=1792; Antisense; AACCATTGGGCGTCCTTTTATTCAT
>probe:Drosophila_2:1630805_at:70:415; Interrogation_Position=1825; Antisense; GACCATGGATCAGCCAACGATTCAT

Paste this into a BLAST search page for me
ACTTGCCGCTCGGATGGGACGGTAATAAACCTATCCCCTACTGGTTGTATGGTTGTATAAACTGCATGGCCTGAATGGAAACTTCACCTACAAGGGTCCTGTCCTAAGGCTTTTCAACGACACTTAATGTCACCCAGATCGAGGACGCAAGAGGACGCAATCACGTTGTGGGAAAACTCGCTGGGAAACGTTGTCAACCGGATCTAAAACGCCAGGGTCTACTTTGGACAAGCCTACGATTATGGTCGCTTATGGTCGCTTGAGTACCGGTCAATTATATGACGCTTCCTCTAAAACCTCAACCATTGGGCGTCCTTTTATTCATGACCATGGATCAGCCAACGATTCAT

Full Affymetrix probeset data:

Annotations for 1630805_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720