Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630806_at:

>probe:Drosophila_2:1630806_at:668:155; Interrogation_Position=2504; Antisense; CAGCCCCACTTAGCGGAATAGTAGA
>probe:Drosophila_2:1630806_at:720:643; Interrogation_Position=2553; Antisense; TCTAGTATAGCACCAATCTCCCAAC
>probe:Drosophila_2:1630806_at:67:419; Interrogation_Position=2609; Antisense; GAGTAAACATTTCTGCCTTTGAAGT
>probe:Drosophila_2:1630806_at:608:423; Interrogation_Position=2635; Antisense; GAGAACACAATTAAGCATCCCCTGG
>probe:Drosophila_2:1630806_at:339:337; Interrogation_Position=2649; Antisense; GCATCCCCTGGTTAAACCTGACATT
>probe:Drosophila_2:1630806_at:27:275; Interrogation_Position=2670; Antisense; CATTCATACTTGTTAATAGCGCCAT
>probe:Drosophila_2:1630806_at:591:193; Interrogation_Position=2756; Antisense; AACTCTGCTGACTTCAAAACGAGAA
>probe:Drosophila_2:1630806_at:442:567; Interrogation_Position=2800; Antisense; GGCACAGTTTATAGACCACCGACGG
>probe:Drosophila_2:1630806_at:60:337; Interrogation_Position=2824; Antisense; GCTCGTTAGGGCTCGTCATGTAACT
>probe:Drosophila_2:1630806_at:134:299; Interrogation_Position=2852; Antisense; CGCGGTGAAACCCAATTGAACATAT
>probe:Drosophila_2:1630806_at:131:181; Interrogation_Position=2972; Antisense; AAAAATCTGGCCCTTTGACCTTGCT
>probe:Drosophila_2:1630806_at:174:611; Interrogation_Position=2987; Antisense; TGACCTTGCTTGTCAGGTGCATTTG
>probe:Drosophila_2:1630806_at:260:531; Interrogation_Position=3011; Antisense; GGGTTCAATCGTAAGTTGCTTCTAT
>probe:Drosophila_2:1630806_at:621:631; Interrogation_Position=3046; Antisense; TCCCCATCCCCGCAATAATGAAGAA

Paste this into a BLAST search page for me
CAGCCCCACTTAGCGGAATAGTAGATCTAGTATAGCACCAATCTCCCAACGAGTAAACATTTCTGCCTTTGAAGTGAGAACACAATTAAGCATCCCCTGGGCATCCCCTGGTTAAACCTGACATTCATTCATACTTGTTAATAGCGCCATAACTCTGCTGACTTCAAAACGAGAAGGCACAGTTTATAGACCACCGACGGGCTCGTTAGGGCTCGTCATGTAACTCGCGGTGAAACCCAATTGAACATATAAAAATCTGGCCCTTTGACCTTGCTTGACCTTGCTTGTCAGGTGCATTTGGGGTTCAATCGTAAGTTGCTTCTATTCCCCATCCCCGCAATAATGAAGAA

Full Affymetrix probeset data:

Annotations for 1630806_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime