Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630807_at:

>probe:Drosophila_2:1630807_at:502:285; Interrogation_Position=1935; Antisense; CTGAGTGACCATATTGCCGGACATA
>probe:Drosophila_2:1630807_at:276:389; Interrogation_Position=2000; Antisense; GAAACATCAGGTACAGGCCGAGGCT
>probe:Drosophila_2:1630807_at:233:617; Interrogation_Position=2024; Antisense; TGCAACAGGTCTTGACGCTCTGATG
>probe:Drosophila_2:1630807_at:409:435; Interrogation_Position=2065; Antisense; GAGGTGTGACCCTGCGAAGACGCAA
>probe:Drosophila_2:1630807_at:554:353; Interrogation_Position=2104; Antisense; GCACCAGCGAGGCTCTCAAGGAGAT
>probe:Drosophila_2:1630807_at:723:163; Interrogation_Position=2173; Antisense; AAATATGCGTGGATCTGCACTCGTC
>probe:Drosophila_2:1630807_at:449:259; Interrogation_Position=2190; Antisense; CACTCGTCCCGTGGAGTTGATGTTT
>probe:Drosophila_2:1630807_at:618:93; Interrogation_Position=2204; Antisense; AGTTGATGTTTGATCCTGTTCCTGA
>probe:Drosophila_2:1630807_at:123:147; Interrogation_Position=2243; Antisense; ACTCTCTTACACCTTGGTCTCAAAT
>probe:Drosophila_2:1630807_at:502:619; Interrogation_Position=2278; Antisense; TGCTGTCCCTGAACAACGAACATTC
>probe:Drosophila_2:1630807_at:35:149; Interrogation_Position=2297; Antisense; ACATTCCGTGCATTTTCAAACCGTA
>probe:Drosophila_2:1630807_at:146:199; Interrogation_Position=2315; Antisense; AACCGTATTATTGTGTGCCTTTTCA
>probe:Drosophila_2:1630807_at:479:201; Interrogation_Position=2467; Antisense; AACCGGCCTGGCTAATGTGTTCATT
>probe:Drosophila_2:1630807_at:297:643; Interrogation_Position=2492; Antisense; TTTGACAGGTCTCGCGTTTTACTAA

Paste this into a BLAST search page for me
CTGAGTGACCATATTGCCGGACATAGAAACATCAGGTACAGGCCGAGGCTTGCAACAGGTCTTGACGCTCTGATGGAGGTGTGACCCTGCGAAGACGCAAGCACCAGCGAGGCTCTCAAGGAGATAAATATGCGTGGATCTGCACTCGTCCACTCGTCCCGTGGAGTTGATGTTTAGTTGATGTTTGATCCTGTTCCTGAACTCTCTTACACCTTGGTCTCAAATTGCTGTCCCTGAACAACGAACATTCACATTCCGTGCATTTTCAAACCGTAAACCGTATTATTGTGTGCCTTTTCAAACCGGCCTGGCTAATGTGTTCATTTTTGACAGGTCTCGCGTTTTACTAA

Full Affymetrix probeset data:

Annotations for 1630807_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime