FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630811_at:

>probe:Drosophila_2:1630811_at:56:637; Interrogation_Position=526; Antisense; TCGCAATTGCTTCCAGTGCAACAAA
>probe:Drosophila_2:1630811_at:270:247; Interrogation_Position=529; Antisense; CAATTGCTTCCAGTGCAACAAATGC
>probe:Drosophila_2:1630811_at:506:151; Interrogation_Position=625; Antisense; ACATCGTCCCGGACCCATGATCTTA
>probe:Drosophila_2:1630811_at:495:289; Interrogation_Position=634; Antisense; CGGACCCATGATCTTACTCCAAATT
>probe:Drosophila_2:1630811_at:710:411; Interrogation_Position=636; Antisense; GACCCATGATCTTACTCCAAATTGT
>probe:Drosophila_2:1630811_at:644:267; Interrogation_Position=640; Antisense; CATGATCTTACTCCAAATTGTTTAG
>probe:Drosophila_2:1630811_at:618:271; Interrogation_Position=645; Antisense; TCTTACTCCAAATTGTTTAGTTCCT
>probe:Drosophila_2:1630811_at:624:477; Interrogation_Position=659; Antisense; GTTTAGTTCCTTTCTTACACTAATG
>probe:Drosophila_2:1630811_at:200:93; Interrogation_Position=663; Antisense; AGTTCCTTTCTTACACTAATGTTGA
>probe:Drosophila_2:1630811_at:108:469; Interrogation_Position=664; Antisense; GTTCCTTTCTTACACTAATGTTGAA
>probe:Drosophila_2:1630811_at:685:395; Interrogation_Position=686; Antisense; GAAATAGTTCCCGATGCTTATGAAG
>probe:Drosophila_2:1630811_at:699:23; Interrogation_Position=689; Antisense; ATAGTTCCCGATGCTTATGAAGCCT
>probe:Drosophila_2:1630811_at:224:471; Interrogation_Position=692; Antisense; GTTCCCGATGCTTATGAAGCCTAGA
>probe:Drosophila_2:1630811_at:546:253; Interrogation_Position=695; Antisense; CCCGATGCTTATGAAGCCTAGAGGC

Paste this into a BLAST search page for me
TCGCAATTGCTTCCAGTGCAACAAACAATTGCTTCCAGTGCAACAAATGCACATCGTCCCGGACCCATGATCTTACGGACCCATGATCTTACTCCAAATTGACCCATGATCTTACTCCAAATTGTCATGATCTTACTCCAAATTGTTTAGTCTTACTCCAAATTGTTTAGTTCCTGTTTAGTTCCTTTCTTACACTAATGAGTTCCTTTCTTACACTAATGTTGAGTTCCTTTCTTACACTAATGTTGAAGAAATAGTTCCCGATGCTTATGAAGATAGTTCCCGATGCTTATGAAGCCTGTTCCCGATGCTTATGAAGCCTAGACCCGATGCTTATGAAGCCTAGAGGC

Full Affymetrix probeset data:

Annotations for 1630811_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720