FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630813_at:

>probe:Drosophila_2:1630813_at:38:445; Interrogation_Position=130; Antisense; GATGAGGGATCTGCACATCCGCAAA
>probe:Drosophila_2:1630813_at:49:179; Interrogation_Position=152; Antisense; AAACTCTGCCTGAACATCTGCGTGG
>probe:Drosophila_2:1630813_at:323:591; Interrogation_Position=229; Antisense; TGGTCAGCAGCCAGTGTTCTCCAAG
>probe:Drosophila_2:1630813_at:228:715; Interrogation_Position=271; Antisense; TTCGTTCGGTATTCGCCGTAACGAG
>probe:Drosophila_2:1630813_at:708:659; Interrogation_Position=289; Antisense; TAACGAGAAGATCGCTGTCCACTGC
>probe:Drosophila_2:1630813_at:722:487; Interrogation_Position=370; Antisense; GTACGAGCTGCGTCGGGAGAACTTC
>probe:Drosophila_2:1630813_at:230:255; Interrogation_Position=406; Antisense; CAACTTCGGTTTCGGCATCCAGGAA
>probe:Drosophila_2:1630813_at:293:561; Interrogation_Position=427; Antisense; GGAACACATCGATCTGGGCATCAAG
>probe:Drosophila_2:1630813_at:176:215; Interrogation_Position=449; Antisense; AAGTACGATCCCTCCATCGGTATCT
>probe:Drosophila_2:1630813_at:545:41; Interrogation_Position=464; Antisense; ATCGGTATCTATGGTCTGGACTTCT
>probe:Drosophila_2:1630813_at:535:379; Interrogation_Position=520; Antisense; GAACCACAGGAAGCGCAAGTCCGGC
>probe:Drosophila_2:1630813_at:124:449; Interrogation_Position=578; Antisense; GATGCCATGAAGTGGTTCCAGCAGA
>probe:Drosophila_2:1630813_at:220:437; Interrogation_Position=637; Antisense; GAGGAGCTCTATCAGTAACCATGTT
>probe:Drosophila_2:1630813_at:194:661; Interrogation_Position=682; Antisense; TAAACCTTGGCTTGTGTCAACACGT

Paste this into a BLAST search page for me
GATGAGGGATCTGCACATCCGCAAAAAACTCTGCCTGAACATCTGCGTGGTGGTCAGCAGCCAGTGTTCTCCAAGTTCGTTCGGTATTCGCCGTAACGAGTAACGAGAAGATCGCTGTCCACTGCGTACGAGCTGCGTCGGGAGAACTTCCAACTTCGGTTTCGGCATCCAGGAAGGAACACATCGATCTGGGCATCAAGAAGTACGATCCCTCCATCGGTATCTATCGGTATCTATGGTCTGGACTTCTGAACCACAGGAAGCGCAAGTCCGGCGATGCCATGAAGTGGTTCCAGCAGAGAGGAGCTCTATCAGTAACCATGTTTAAACCTTGGCTTGTGTCAACACGT

Full Affymetrix probeset data:

Annotations for 1630813_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720