Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630815_at:

>probe:Drosophila_2:1630815_at:355:273; Interrogation_Position=129; Antisense; CATTATGACGGTGGGCAGTGACTTC
>probe:Drosophila_2:1630815_at:636:59; Interrogation_Position=13; Antisense; ATGTTGCGTCTGATTTGCGTGTTCC
>probe:Drosophila_2:1630815_at:517:369; Interrogation_Position=171; Antisense; GAAGTGTGAACTGGTACCCTCGGGC
>probe:Drosophila_2:1630815_at:442:133; Interrogation_Position=186; Antisense; ACCCTCGGGCTGCATCATGAACAAG
>probe:Drosophila_2:1630815_at:175:713; Interrogation_Position=214; Antisense; TTCAGTACCGCGGTGGCTAAGTTCA
>probe:Drosophila_2:1630815_at:204:215; Interrogation_Position=274; Antisense; AAGATCGATCTATGCGCCGCCATTG
>probe:Drosophila_2:1630815_at:580:439; Interrogation_Position=298; Antisense; GATCAGGCCTCCTCCGAAGGTAAGG
>probe:Drosophila_2:1630815_at:637:339; Interrogation_Position=327; Antisense; GCTAAAGCTTTTCGGAGCACCTTCC
>probe:Drosophila_2:1630815_at:250:75; Interrogation_Position=368; Antisense; AGGAGAAGGTGTGCGCCAACGATCA
>probe:Drosophila_2:1630815_at:287:199; Interrogation_Position=385; Antisense; AACGATCACTCCGTGGATCTGAGCA
>probe:Drosophila_2:1630815_at:644:269; Interrogation_Position=420; Antisense; CATGTTGGGCATGGCTCGTGGTCAC
>probe:Drosophila_2:1630815_at:446:519; Interrogation_Position=437; Antisense; GTGGTCACCTCATCATCGATTCTGA
>probe:Drosophila_2:1630815_at:223:361; Interrogation_Position=479; Antisense; GCAAGTCCTGCATTCATGCCGAAAT
>probe:Drosophila_2:1630815_at:568:315; Interrogation_Position=64; Antisense; GCCTTGGCTTGCAATGGCTACAAAG

Paste this into a BLAST search page for me
CATTATGACGGTGGGCAGTGACTTCATGTTGCGTCTGATTTGCGTGTTCCGAAGTGTGAACTGGTACCCTCGGGCACCCTCGGGCTGCATCATGAACAAGTTCAGTACCGCGGTGGCTAAGTTCAAAGATCGATCTATGCGCCGCCATTGGATCAGGCCTCCTCCGAAGGTAAGGGCTAAAGCTTTTCGGAGCACCTTCCAGGAGAAGGTGTGCGCCAACGATCAAACGATCACTCCGTGGATCTGAGCACATGTTGGGCATGGCTCGTGGTCACGTGGTCACCTCATCATCGATTCTGAGCAAGTCCTGCATTCATGCCGAAATGCCTTGGCTTGCAATGGCTACAAAG

Full Affymetrix probeset data:

Annotations for 1630815_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime