FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630816_at:

>probe:Drosophila_2:1630816_at:197:653; Interrogation_Position=335; Antisense; TCAACTTCAAGCTTATCATCTCGCC
>probe:Drosophila_2:1630816_at:696:79; Interrogation_Position=365; Antisense; AGGGCTTCTACAGAGACGGGCGCTT
>probe:Drosophila_2:1630816_at:301:715; Interrogation_Position=388; Antisense; TTCGTGTTCAATTTCCGCGTCGGAT
>probe:Drosophila_2:1630816_at:444:533; Interrogation_Position=456; Antisense; GGTGTACCATCCCAATATTGACCTG
>probe:Drosophila_2:1630816_at:415:689; Interrogation_Position=471; Antisense; TATTGACCTGGATGGCAACGTCTGC
>probe:Drosophila_2:1630816_at:703:367; Interrogation_Position=519; Antisense; GAATCCAGTGCTGAACATCAACTCC
>probe:Drosophila_2:1630816_at:553:271; Interrogation_Position=543; Antisense; CATCGTCTATGGCTTGCAGTTTCTA
>probe:Drosophila_2:1630816_at:714:347; Interrogation_Position=558; Antisense; GCAGTTTCTATTCTTGGAACCCAAT
>probe:Drosophila_2:1630816_at:680:253; Interrogation_Position=627; Antisense; CAACCGCCGTCAGTTCGAGAACAAT
>probe:Drosophila_2:1630816_at:46:517; Interrogation_Position=679; Antisense; GTGGGCGAGACCTACTTCGAGTGCT
>probe:Drosophila_2:1630816_at:376:717; Interrogation_Position=694; Antisense; TTCGAGTGCTGTCTGCTCAAGTGAT
>probe:Drosophila_2:1630816_at:229:687; Interrogation_Position=718; Antisense; TATAGGGAATCGCAAGGTCTCTTAC
>probe:Drosophila_2:1630816_at:2:497; Interrogation_Position=734; Antisense; GTCTCTTACTTTAAGCCTGTCCATA
>probe:Drosophila_2:1630816_at:511:375; Interrogation_Position=866; Antisense; GAAGAAGCCGAGTCAAGTCACCAAT

Paste this into a BLAST search page for me
TCAACTTCAAGCTTATCATCTCGCCAGGGCTTCTACAGAGACGGGCGCTTTTCGTGTTCAATTTCCGCGTCGGATGGTGTACCATCCCAATATTGACCTGTATTGACCTGGATGGCAACGTCTGCGAATCCAGTGCTGAACATCAACTCCCATCGTCTATGGCTTGCAGTTTCTAGCAGTTTCTATTCTTGGAACCCAATCAACCGCCGTCAGTTCGAGAACAATGTGGGCGAGACCTACTTCGAGTGCTTTCGAGTGCTGTCTGCTCAAGTGATTATAGGGAATCGCAAGGTCTCTTACGTCTCTTACTTTAAGCCTGTCCATAGAAGAAGCCGAGTCAAGTCACCAAT

Full Affymetrix probeset data:

Annotations for 1630816_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720