FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630818_at:

>probe:Drosophila_2:1630818_at:178:623; Interrogation_Position=161; Antisense; TGCGGCCTGGTGGTTGATCCTAAAC
>probe:Drosophila_2:1630818_at:528:445; Interrogation_Position=176; Antisense; GATCCTAAACTGTTTTTCGCGGTGG
>probe:Drosophila_2:1630818_at:689:499; Interrogation_Position=212; Antisense; GTCTGCAGCGAGTGCTATCTGGACA
>probe:Drosophila_2:1630818_at:538:683; Interrogation_Position=227; Antisense; TATCTGGACAAGCATGCCGCTCGGT
>probe:Drosophila_2:1630818_at:356:171; Interrogation_Position=316; Antisense; AAAGTGTTTCCGGTGCGTGAGCTGC
>probe:Drosophila_2:1630818_at:659:533; Interrogation_Position=352; Antisense; GGTCTCGGCGAGCTTCTTTGAAGTC
>probe:Drosophila_2:1630818_at:219:219; Interrogation_Position=372; Antisense; AAGTCAACGGATACCTGTTCTGCAA
>probe:Drosophila_2:1630818_at:64:107; Interrogation_Position=44; Antisense; AGAAAGCTGCCTAGTATGTCCGCTT
>probe:Drosophila_2:1630818_at:543:107; Interrogation_Position=441; Antisense; AGAAGCCAATCGATCGTCGAGCCGT
>probe:Drosophila_2:1630818_at:33:503; Interrogation_Position=467; Antisense; GTCGCGCTGAGCACCAAGTGGCATG
>probe:Drosophila_2:1630818_at:125:627; Interrogation_Position=490; Antisense; TGCCAAGTGCTTTAAGTGCCACCAC
>probe:Drosophila_2:1630818_at:494:421; Interrogation_Position=551; Antisense; GAGAACGGTCAACCCATTTGCGCAG
>probe:Drosophila_2:1630818_at:315:111; Interrogation_Position=574; Antisense; AGCCTGCCAAACTGTAGTCCCGAGT
>probe:Drosophila_2:1630818_at:629:61; Interrogation_Position=59; Antisense; ATGTCCGCTTCAATTTGCTGCAGAT

Paste this into a BLAST search page for me
TGCGGCCTGGTGGTTGATCCTAAACGATCCTAAACTGTTTTTCGCGGTGGGTCTGCAGCGAGTGCTATCTGGACATATCTGGACAAGCATGCCGCTCGGTAAAGTGTTTCCGGTGCGTGAGCTGCGGTCTCGGCGAGCTTCTTTGAAGTCAAGTCAACGGATACCTGTTCTGCAAAGAAAGCTGCCTAGTATGTCCGCTTAGAAGCCAATCGATCGTCGAGCCGTGTCGCGCTGAGCACCAAGTGGCATGTGCCAAGTGCTTTAAGTGCCACCACGAGAACGGTCAACCCATTTGCGCAGAGCCTGCCAAACTGTAGTCCCGAGTATGTCCGCTTCAATTTGCTGCAGAT

Full Affymetrix probeset data:

Annotations for 1630818_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720