FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630819_at:

>probe:Drosophila_2:1630819_at:166:293; Interrogation_Position=16; Antisense; CGATATTCAGTCCAAATCGTAGAAT
>probe:Drosophila_2:1630819_at:400:719; Interrogation_Position=176; Antisense; TTCCACCGGGCGCAAGAACATAAGA
>probe:Drosophila_2:1630819_at:403:83; Interrogation_Position=340; Antisense; AGTGGAATGCCTTCAAGGAGCACCA
>probe:Drosophila_2:1630819_at:679:75; Interrogation_Position=355; Antisense; AGGAGCACCAGACGGAGTCGTTTCC
>probe:Drosophila_2:1630819_at:473:431; Interrogation_Position=369; Antisense; GAGTCGTTTCCCCATATCTATGAAG
>probe:Drosophila_2:1630819_at:420:21; Interrogation_Position=382; Antisense; ATATCTATGAAGCTCCGTTGTCCTC
>probe:Drosophila_2:1630819_at:72:467; Interrogation_Position=398; Antisense; GTTGTCCTCTCGATTCTCAAAAACT
>probe:Drosophila_2:1630819_at:462:701; Interrogation_Position=440; Antisense; TTTTGTGTACGACAGCAAGGATGAA
>probe:Drosophila_2:1630819_at:288:377; Interrogation_Position=462; Antisense; GAAGCAATGGCTCCGATCTGCAGGA
>probe:Drosophila_2:1630819_at:574:39; Interrogation_Position=477; Antisense; ATCTGCAGGACGTGCTTCTCAAAGG
>probe:Drosophila_2:1630819_at:728:713; Interrogation_Position=492; Antisense; TTCTCAAAGGCCAAGTGCTTTCACT
>probe:Drosophila_2:1630819_at:602:85; Interrogation_Position=505; Antisense; AGTGCTTTCACTAAACGTTTGCTAA
>probe:Drosophila_2:1630819_at:242:697; Interrogation_Position=537; Antisense; TTTAGTCACAAACAACCAGCAAAAG
>probe:Drosophila_2:1630819_at:59:359; Interrogation_Position=555; Antisense; GCAAAAGTTGCGAGATGTTGTTCAA

Paste this into a BLAST search page for me
CGATATTCAGTCCAAATCGTAGAATTTCCACCGGGCGCAAGAACATAAGAAGTGGAATGCCTTCAAGGAGCACCAAGGAGCACCAGACGGAGTCGTTTCCGAGTCGTTTCCCCATATCTATGAAGATATCTATGAAGCTCCGTTGTCCTCGTTGTCCTCTCGATTCTCAAAAACTTTTTGTGTACGACAGCAAGGATGAAGAAGCAATGGCTCCGATCTGCAGGAATCTGCAGGACGTGCTTCTCAAAGGTTCTCAAAGGCCAAGTGCTTTCACTAGTGCTTTCACTAAACGTTTGCTAATTTAGTCACAAACAACCAGCAAAAGGCAAAAGTTGCGAGATGTTGTTCAA

Full Affymetrix probeset data:

Annotations for 1630819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720