FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630820_at:

>probe:Drosophila_2:1630820_at:587:213; Interrogation_Position=234; Antisense; AAGAGATTCGTCCAACTACTTCGAC
>probe:Drosophila_2:1630820_at:203:227; Interrogation_Position=341; Antisense; AATGGAAGGAGGATCGTCAGTACTA
>probe:Drosophila_2:1630820_at:505:495; Interrogation_Position=356; Antisense; GTCAGTACTACGATGCAACTATTGA
>probe:Drosophila_2:1630820_at:671:473; Interrogation_Position=403; Antisense; GTTAATGTAATATTCGATGCCTATC
>probe:Drosophila_2:1630820_at:75:449; Interrogation_Position=418; Antisense; GATGCCTATCAAAATCGATCTACGA
>probe:Drosophila_2:1630820_at:109:453; Interrogation_Position=434; Antisense; GATCTACGACCCACGTCAATGAGTT
>probe:Drosophila_2:1630820_at:546:291; Interrogation_Position=447; Antisense; CGTCAATGAGTTGCGTGAACGTACT
>probe:Drosophila_2:1630820_at:158:509; Interrogation_Position=461; Antisense; GTGAACGTACTATTCGCAACGAAGT
>probe:Drosophila_2:1630820_at:67:477; Interrogation_Position=484; Antisense; GTTTTTCCGTCAAACAAGCGGCACA
>probe:Drosophila_2:1630820_at:368:331; Interrogation_Position=501; Antisense; GCGGCACAGGCCCAATCAAAAAGAA
>probe:Drosophila_2:1630820_at:368:111; Interrogation_Position=551; Antisense; AGCAACAGCGCTTCAAGGACTTGGA
>probe:Drosophila_2:1630820_at:382:107; Interrogation_Position=652; Antisense; AGAAGTATATTTGCGTCTCCGGATA
>probe:Drosophila_2:1630820_at:35:21; Interrogation_Position=658; Antisense; ATATTTGCGTCTCCGGATAATGTAA
>probe:Drosophila_2:1630820_at:293:75; Interrogation_Position=693; Antisense; AGGAGTCGGCACTTGTGGAACTGCA

Paste this into a BLAST search page for me
AAGAGATTCGTCCAACTACTTCGACAATGGAAGGAGGATCGTCAGTACTAGTCAGTACTACGATGCAACTATTGAGTTAATGTAATATTCGATGCCTATCGATGCCTATCAAAATCGATCTACGAGATCTACGACCCACGTCAATGAGTTCGTCAATGAGTTGCGTGAACGTACTGTGAACGTACTATTCGCAACGAAGTGTTTTTCCGTCAAACAAGCGGCACAGCGGCACAGGCCCAATCAAAAAGAAAGCAACAGCGCTTCAAGGACTTGGAAGAAGTATATTTGCGTCTCCGGATAATATTTGCGTCTCCGGATAATGTAAAGGAGTCGGCACTTGTGGAACTGCA

Full Affymetrix probeset data:

Annotations for 1630820_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720