FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630821_at:

>probe:Drosophila_2:1630821_at:592:241; Interrogation_Position=1019; Antisense; AATAGGTTGAGGATCGTGTGCCGCA
>probe:Drosophila_2:1630821_at:635:447; Interrogation_Position=1124; Antisense; GATCCACCGTTATTGCTTATTCGAT
>probe:Drosophila_2:1630821_at:38:71; Interrogation_Position=611; Antisense; AGGCCATTAGGCACCTTCAGGAGAA
>probe:Drosophila_2:1630821_at:41:411; Interrogation_Position=637; Antisense; GACGACTGCCAGTTGATAGCCGGCG
>probe:Drosophila_2:1630821_at:121:123; Interrogation_Position=664; Antisense; AGCGATGTCATCATGCCACTGGCGG
>probe:Drosophila_2:1630821_at:142:367; Interrogation_Position=690; Antisense; GAATCTCAATGTGGCCGGGTTCTTT
>probe:Drosophila_2:1630821_at:216:529; Interrogation_Position=706; Antisense; GGGTTCTTTGACTTCCTGGAGCACG
>probe:Drosophila_2:1630821_at:666:713; Interrogation_Position=815; Antisense; TTCGTGATTGCAAGCGCTGCATCTT
>probe:Drosophila_2:1630821_at:410:267; Interrogation_Position=859; Antisense; CAGGATGTGCAGTTCGGCAAGGCCT
>probe:Drosophila_2:1630821_at:336:539; Interrogation_Position=903; Antisense; GGTACTTAGCGGCTGCCTAACAAAG
>probe:Drosophila_2:1630821_at:369:73; Interrogation_Position=929; Antisense; AGGACATGCTGAACGCCCCGGTGGA
>probe:Drosophila_2:1630821_at:65:533; Interrogation_Position=948; Antisense; GGTGGAAGCGCAGCCGGATTACTAT
>probe:Drosophila_2:1630821_at:29:15; Interrogation_Position=965; Antisense; ATTACTATGCCGATAGCCTGGCCGA
>probe:Drosophila_2:1630821_at:612:295; Interrogation_Position=987; Antisense; CGACTTCACGCAGCTGCTTGAAAAT

Paste this into a BLAST search page for me
AATAGGTTGAGGATCGTGTGCCGCAGATCCACCGTTATTGCTTATTCGATAGGCCATTAGGCACCTTCAGGAGAAGACGACTGCCAGTTGATAGCCGGCGAGCGATGTCATCATGCCACTGGCGGGAATCTCAATGTGGCCGGGTTCTTTGGGTTCTTTGACTTCCTGGAGCACGTTCGTGATTGCAAGCGCTGCATCTTCAGGATGTGCAGTTCGGCAAGGCCTGGTACTTAGCGGCTGCCTAACAAAGAGGACATGCTGAACGCCCCGGTGGAGGTGGAAGCGCAGCCGGATTACTATATTACTATGCCGATAGCCTGGCCGACGACTTCACGCAGCTGCTTGAAAAT

Full Affymetrix probeset data:

Annotations for 1630821_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720