FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630822_at:

>probe:Drosophila_2:1630822_at:704:19; Interrogation_Position=106; Antisense; ATTTGGATCAGCTGGACCTGCTTGC
>probe:Drosophila_2:1630822_at:325:705; Interrogation_Position=170; Antisense; TTACCTTCGGTTTTGTGTTCCTGAT
>probe:Drosophila_2:1630822_at:374:231; Interrogation_Position=204; Antisense; AATGATGTGCTTCTACGACGGCAGT
>probe:Drosophila_2:1630822_at:340:661; Interrogation_Position=233; Antisense; TAACTGTGCGTTACTCCCGGAATTA
>probe:Drosophila_2:1630822_at:220:709; Interrogation_Position=255; Antisense; TTACAAGACTGCCTTTCACGTGGTC
>probe:Drosophila_2:1630822_at:40:523; Interrogation_Position=307; Antisense; GTGGCCGGCTGTTTGATTCAACTAA
>probe:Drosophila_2:1630822_at:212:465; Interrogation_Position=340; Antisense; GATTGGTCAATCAGCGTCACGTTAC
>probe:Drosophila_2:1630822_at:356:631; Interrogation_Position=392; Antisense; TCCTGTGTCTGATCTCATTGCTGAG
>probe:Drosophila_2:1630822_at:240:583; Interrogation_Position=524; Antisense; TGGCGCAGTTTTACGGATACACACA
>probe:Drosophila_2:1630822_at:451:153; Interrogation_Position=573; Antisense; ACAGGATTTCGTTGTCCTCATGCAG
>probe:Drosophila_2:1630822_at:623:53; Interrogation_Position=592; Antisense; ATGCAGGTCGTCACTATGGTCCTAA
>probe:Drosophila_2:1630822_at:149:535; Interrogation_Position=609; Antisense; GGTCCTAATGGTCCTAACCAGCATT
>probe:Drosophila_2:1630822_at:635:313; Interrogation_Position=637; Antisense; GCCATTAAGTCGCTCTACCAGAAGA
>probe:Drosophila_2:1630822_at:447:339; Interrogation_Position=89; Antisense; GCATAGGATTCGTCACCATTTGGAT

Paste this into a BLAST search page for me
ATTTGGATCAGCTGGACCTGCTTGCTTACCTTCGGTTTTGTGTTCCTGATAATGATGTGCTTCTACGACGGCAGTTAACTGTGCGTTACTCCCGGAATTATTACAAGACTGCCTTTCACGTGGTCGTGGCCGGCTGTTTGATTCAACTAAGATTGGTCAATCAGCGTCACGTTACTCCTGTGTCTGATCTCATTGCTGAGTGGCGCAGTTTTACGGATACACACAACAGGATTTCGTTGTCCTCATGCAGATGCAGGTCGTCACTATGGTCCTAAGGTCCTAATGGTCCTAACCAGCATTGCCATTAAGTCGCTCTACCAGAAGAGCATAGGATTCGTCACCATTTGGAT

Full Affymetrix probeset data:

Annotations for 1630822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720