Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630825_at:

>probe:Drosophila_2:1630825_at:663:363; Interrogation_Position=2625; Antisense; GAATCGCGGGCGGTAACACCTAAGA
>probe:Drosophila_2:1630825_at:189:239; Interrogation_Position=2673; Antisense; AATCACTACGGCACCATGGAAGGCG
>probe:Drosophila_2:1630825_at:186:227; Interrogation_Position=2692; Antisense; AAGGCGGGCACTACACGGCATTTTG
>probe:Drosophila_2:1630825_at:101:571; Interrogation_Position=2708; Antisense; GGCATTTTGCAAGAGCGCCAACTAC
>probe:Drosophila_2:1630825_at:425:659; Interrogation_Position=2783; Antisense; TAACGTGGTTTCTAGCGCTGCATAC
>probe:Drosophila_2:1630825_at:482:619; Interrogation_Position=2801; Antisense; TGCATACATTCTTTTCTACACCTGG
>probe:Drosophila_2:1630825_at:222:53; Interrogation_Position=2835; Antisense; ATGCAGGTGCCTCTGTAGACGCTTC
>probe:Drosophila_2:1630825_at:222:667; Interrogation_Position=2924; Antisense; TAGCTTTTAAGGTCTAGTCGCCACA
>probe:Drosophila_2:1630825_at:614:311; Interrogation_Position=2943; Antisense; GCCACACCCTTTTATCATTTACAAA
>probe:Drosophila_2:1630825_at:694:343; Interrogation_Position=3007; Antisense; GCTTGTTTGTTGTTGTCTAGGCTCT
>probe:Drosophila_2:1630825_at:600:127; Interrogation_Position=3044; Antisense; ACGCGTGGGCGTATTTTCAATGGGT
>probe:Drosophila_2:1630825_at:158:619; Interrogation_Position=3068; Antisense; TGCAGGCTGCATTCACTAAAACCAA
>probe:Drosophila_2:1630825_at:539:213; Interrogation_Position=3121; Antisense; AAGAGAAGCCCGCATATACGCCTGT
>probe:Drosophila_2:1630825_at:173:27; Interrogation_Position=3136; Antisense; ATACGCCTGTGTATGCGGGACTATA

Paste this into a BLAST search page for me
GAATCGCGGGCGGTAACACCTAAGAAATCACTACGGCACCATGGAAGGCGAAGGCGGGCACTACACGGCATTTTGGGCATTTTGCAAGAGCGCCAACTACTAACGTGGTTTCTAGCGCTGCATACTGCATACATTCTTTTCTACACCTGGATGCAGGTGCCTCTGTAGACGCTTCTAGCTTTTAAGGTCTAGTCGCCACAGCCACACCCTTTTATCATTTACAAAGCTTGTTTGTTGTTGTCTAGGCTCTACGCGTGGGCGTATTTTCAATGGGTTGCAGGCTGCATTCACTAAAACCAAAAGAGAAGCCCGCATATACGCCTGTATACGCCTGTGTATGCGGGACTATA

Full Affymetrix probeset data:

Annotations for 1630825_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime