Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630829_at:

>probe:Drosophila_2:1630829_at:272:657; Interrogation_Position=2809; Antisense; TAAGGTGCTCAGGATGGCATCCCGT
>probe:Drosophila_2:1630829_at:668:569; Interrogation_Position=2824; Antisense; GGCATCCCGTTGGTGATCAGAGATC
>probe:Drosophila_2:1630829_at:425:603; Interrogation_Position=2851; Antisense; TGATCAGTGATTCGTAGTCCCGGTC
>probe:Drosophila_2:1630829_at:308:623; Interrogation_Position=2874; Antisense; TCCCCTATACGTTTAGTGTACGGTG
>probe:Drosophila_2:1630829_at:162:211; Interrogation_Position=2901; Antisense; AAGAGTTCGTTATGCGTTCGATCAG
>probe:Drosophila_2:1630829_at:678:701; Interrogation_Position=2971; Antisense; TTTTGCGATACTTTCGATCTCCGAT
>probe:Drosophila_2:1630829_at:493:277; Interrogation_Position=2981; Antisense; CTTTCGATCTCCGATATATCCACAT
>probe:Drosophila_2:1630829_at:585:129; Interrogation_Position=3023; Antisense; ACCTATGTATAATCAGCAATCGCGA
>probe:Drosophila_2:1630829_at:615:243; Interrogation_Position=3067; Antisense; AATATTTCAATTTACAAGCCAGACA
>probe:Drosophila_2:1630829_at:543:197; Interrogation_Position=3136; Antisense; AACGATAATTGTAACGCGCTTAGGT
>probe:Drosophila_2:1630829_at:150:135; Interrogation_Position=3149; Antisense; ACGCGCTTAGGTTTACTCAACACAA
>probe:Drosophila_2:1630829_at:480:543; Interrogation_Position=3211; Antisense; GGATATTACAATAGGTGCACCAACA
>probe:Drosophila_2:1630829_at:22:511; Interrogation_Position=3225; Antisense; GTGCACCAACAGACGGACTCGGACT
>probe:Drosophila_2:1630829_at:350:281; Interrogation_Position=3242; Antisense; CTCGGACTGCAGACAACATTTGACT

Paste this into a BLAST search page for me
TAAGGTGCTCAGGATGGCATCCCGTGGCATCCCGTTGGTGATCAGAGATCTGATCAGTGATTCGTAGTCCCGGTCTCCCCTATACGTTTAGTGTACGGTGAAGAGTTCGTTATGCGTTCGATCAGTTTTGCGATACTTTCGATCTCCGATCTTTCGATCTCCGATATATCCACATACCTATGTATAATCAGCAATCGCGAAATATTTCAATTTACAAGCCAGACAAACGATAATTGTAACGCGCTTAGGTACGCGCTTAGGTTTACTCAACACAAGGATATTACAATAGGTGCACCAACAGTGCACCAACAGACGGACTCGGACTCTCGGACTGCAGACAACATTTGACT

Full Affymetrix probeset data:

Annotations for 1630829_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime