FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630831_at:

>probe:Drosophila_2:1630831_at:339:213; Interrogation_Position=143; Antisense; AAGAGCTGGTTTGGGCCATGTCCGA
>probe:Drosophila_2:1630831_at:509:409; Interrogation_Position=166; Antisense; GACGAACGTTGCCATGTCTTTCACA
>probe:Drosophila_2:1630831_at:598:497; Interrogation_Position=181; Antisense; GTCTTTCACAACGATTGTCTGCTGA
>probe:Drosophila_2:1630831_at:618:223; Interrogation_Position=205; Antisense; AAGGTCGAGCAGTGCGCCCGAAAAA
>probe:Drosophila_2:1630831_at:390:289; Interrogation_Position=242; Antisense; CGGAGCTGATTGAAACCACGCGGGA
>probe:Drosophila_2:1630831_at:170:529; Interrogation_Position=263; Antisense; GGGAGATCTGCAAACCCAGCTGCAC
>probe:Drosophila_2:1630831_at:378:563; Interrogation_Position=291; Antisense; GGAATGCCCGGATATCTATGACCCA
>probe:Drosophila_2:1630831_at:460:37; Interrogation_Position=304; Antisense; ATCTATGACCCAGTCTGTGCGCAGA
>probe:Drosophila_2:1630831_at:174:597; Interrogation_Position=319; Antisense; TGTGCGCAGATCTTCCAGGAGGAGT
>probe:Drosophila_2:1630831_at:433:439; Interrogation_Position=396; Antisense; GAGGCCGTACTCATTTATTTCCGTC
>probe:Drosophila_2:1630831_at:342:17; Interrogation_Position=412; Antisense; ATTTCCGTCGGTGAATGCGTGGAAC
>probe:Drosophila_2:1630831_at:212:155; Interrogation_Position=435; Antisense; ACAGCCAGTTGGTTAGGTCTAGATA
>probe:Drosophila_2:1630831_at:367:599; Interrogation_Position=575; Antisense; TGCGATTTAACCCACTTCTTTTTAG
>probe:Drosophila_2:1630831_at:280:75; Interrogation_Position=95; Antisense; AGGACGAGCTCTTCCGCTGCAGTGT

Paste this into a BLAST search page for me
AAGAGCTGGTTTGGGCCATGTCCGAGACGAACGTTGCCATGTCTTTCACAGTCTTTCACAACGATTGTCTGCTGAAAGGTCGAGCAGTGCGCCCGAAAAACGGAGCTGATTGAAACCACGCGGGAGGGAGATCTGCAAACCCAGCTGCACGGAATGCCCGGATATCTATGACCCAATCTATGACCCAGTCTGTGCGCAGATGTGCGCAGATCTTCCAGGAGGAGTGAGGCCGTACTCATTTATTTCCGTCATTTCCGTCGGTGAATGCGTGGAACACAGCCAGTTGGTTAGGTCTAGATATGCGATTTAACCCACTTCTTTTTAGAGGACGAGCTCTTCCGCTGCAGTGT

Full Affymetrix probeset data:

Annotations for 1630831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720