Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630834_at:

>probe:Drosophila_2:1630834_at:603:687; Interrogation_Position=2317; Antisense; TATTACGTAAAGTACCACGCTCCCT
>probe:Drosophila_2:1630834_at:352:717; Interrogation_Position=2341; Antisense; TTCGGCGACGTCATGAGATGCTCCA
>probe:Drosophila_2:1630834_at:326:99; Interrogation_Position=2356; Antisense; AGATGCTCCATGGAACTGGCACTTC
>probe:Drosophila_2:1630834_at:141:395; Interrogation_Position=2384; Antisense; GAAATCCCATTCACTTCGCAATGAC
>probe:Drosophila_2:1630834_at:708:151; Interrogation_Position=2419; Antisense; ACATGCCTGCTGCTTTATGCTAAGG
>probe:Drosophila_2:1630834_at:698:77; Interrogation_Position=2441; Antisense; AGGTTTTCCCAGATGATACTCGTCA
>probe:Drosophila_2:1630834_at:625:455; Interrogation_Position=2455; Antisense; GATACTCGTCATGCAGCTGGACAAA
>probe:Drosophila_2:1630834_at:165:263; Interrogation_Position=2492; Antisense; CAGCCGAGTTCTCCGAGCTAATGGA
>probe:Drosophila_2:1630834_at:455:235; Interrogation_Position=2551; Antisense; AATCCCATGGAGCATCGCGAGTGCG
>probe:Drosophila_2:1630834_at:694:451; Interrogation_Position=2591; Antisense; GATCTGGCATTTTGTTCGTCTTTGA
>probe:Drosophila_2:1630834_at:55:209; Interrogation_Position=2650; Antisense; AAGTTACCTTTCTTGCGTGTCCTCA
>probe:Drosophila_2:1630834_at:461:511; Interrogation_Position=2666; Antisense; GTGTCCTCAAGGTGTTTGTTCCGCT
>probe:Drosophila_2:1630834_at:140:697; Interrogation_Position=2727; Antisense; TTTCGAGCCCTATGAGCAACTGATA
>probe:Drosophila_2:1630834_at:208:565; Interrogation_Position=2790; Antisense; GGAATATCGAAACGCCTTGAGGCCT

Paste this into a BLAST search page for me
TATTACGTAAAGTACCACGCTCCCTTTCGGCGACGTCATGAGATGCTCCAAGATGCTCCATGGAACTGGCACTTCGAAATCCCATTCACTTCGCAATGACACATGCCTGCTGCTTTATGCTAAGGAGGTTTTCCCAGATGATACTCGTCAGATACTCGTCATGCAGCTGGACAAACAGCCGAGTTCTCCGAGCTAATGGAAATCCCATGGAGCATCGCGAGTGCGGATCTGGCATTTTGTTCGTCTTTGAAAGTTACCTTTCTTGCGTGTCCTCAGTGTCCTCAAGGTGTTTGTTCCGCTTTTCGAGCCCTATGAGCAACTGATAGGAATATCGAAACGCCTTGAGGCCT

Full Affymetrix probeset data:

Annotations for 1630834_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime