FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630838_at:

>probe:Drosophila_2:1630838_at:159:531; Interrogation_Position=1111; Antisense; GGTGGTGACCTTCTTGAATTCAATT
>probe:Drosophila_2:1630838_at:23:1; Interrogation_Position=1131; Antisense; CAATTTACCGGGTGTTCGACGAGCG
>probe:Drosophila_2:1630838_at:727:145; Interrogation_Position=1197; Antisense; ACTCATATATGGTGGCATCGGGTCT
>probe:Drosophila_2:1630838_at:68:187; Interrogation_Position=1261; Antisense; AACAATGGCCCTTGATTTGCTGGAC
>probe:Drosophila_2:1630838_at:440:461; Interrogation_Position=1303; Antisense; GATTCCCCGGGCAGGAGACGAATTT
>probe:Drosophila_2:1630838_at:148:29; Interrogation_Position=1334; Antisense; ATACGATGCGGTGTGCACACGGGTC
>probe:Drosophila_2:1630838_at:212:635; Interrogation_Position=1365; Antisense; TCGCCGGTATCGTTGGCACCAAAAT
>probe:Drosophila_2:1630838_at:32:399; Interrogation_Position=1412; Antisense; GACACGGTGAACACGGCCTCGCGGA
>probe:Drosophila_2:1630838_at:333:437; Interrogation_Position=1475; Antisense; GAGGAGATGCACGACTCGCTGCAAC
>probe:Drosophila_2:1630838_at:372:331; Interrogation_Position=1527; Antisense; GCGGCCTCATCGATGTCAAGGGTAA
>probe:Drosophila_2:1630838_at:547:531; Interrogation_Position=1552; Antisense; GGGTCTAATGAGCACCTACTGGCTG
>probe:Drosophila_2:1630838_at:275:669; Interrogation_Position=1568; Antisense; TACTGGCTGACCTGCAAGGACGGAC
>probe:Drosophila_2:1630838_at:163:401; Interrogation_Position=1628; Antisense; GACATACAGCCCGTGTTTCTTGACC
>probe:Drosophila_2:1630838_at:714:477; Interrogation_Position=1642; Antisense; GTTTCTTGACCACCTGAAGCTGCAT

Paste this into a BLAST search page for me
GGTGGTGACCTTCTTGAATTCAATTCAATTTACCGGGTGTTCGACGAGCGACTCATATATGGTGGCATCGGGTCTAACAATGGCCCTTGATTTGCTGGACGATTCCCCGGGCAGGAGACGAATTTATACGATGCGGTGTGCACACGGGTCTCGCCGGTATCGTTGGCACCAAAATGACACGGTGAACACGGCCTCGCGGAGAGGAGATGCACGACTCGCTGCAACGCGGCCTCATCGATGTCAAGGGTAAGGGTCTAATGAGCACCTACTGGCTGTACTGGCTGACCTGCAAGGACGGACGACATACAGCCCGTGTTTCTTGACCGTTTCTTGACCACCTGAAGCTGCAT

Full Affymetrix probeset data:

Annotations for 1630838_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720