FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630839_at:

>probe:Drosophila_2:1630839_at:288:213; Interrogation_Position=2006; Antisense; AAGAGGCAACCTCGTAGCTACAACC
>probe:Drosophila_2:1630839_at:461:487; Interrogation_Position=2019; Antisense; GTAGCTACAACCAATCTCTTGGCGT
>probe:Drosophila_2:1630839_at:318:237; Interrogation_Position=2031; Antisense; AATCTCTTGGCGTTTCCATTGGTAT
>probe:Drosophila_2:1630839_at:565:323; Interrogation_Position=2089; Antisense; GCGCGCGACTCGGACACGAAAGCAA
>probe:Drosophila_2:1630839_at:154:83; Interrogation_Position=2140; Antisense; AGTTAAACTCCCTAGTATTCCGATG
>probe:Drosophila_2:1630839_at:32:679; Interrogation_Position=2152; Antisense; TAGTATTCCGATGACCATTCCCTAT
>probe:Drosophila_2:1630839_at:724:631; Interrogation_Position=2170; Antisense; TCCCTATCCTTGTGGCGTTTGGAAA
>probe:Drosophila_2:1630839_at:323:619; Interrogation_Position=2227; Antisense; TGCTTTCTAAAAGTGAGACCCCTGA
>probe:Drosophila_2:1630839_at:392:511; Interrogation_Position=2239; Antisense; GTGAGACCCCTGAATTGAAATTTAA
>probe:Drosophila_2:1630839_at:130:517; Interrogation_Position=2264; Antisense; GTGTGCATTAAACTAAACCAACTCC
>probe:Drosophila_2:1630839_at:5:51; Interrogation_Position=2374; Antisense; ATGCTGGGAGCGTTCTGATAATGGC
>probe:Drosophila_2:1630839_at:348:455; Interrogation_Position=2390; Antisense; GATAATGGCGATTTGTCCGAGCGAT
>probe:Drosophila_2:1630839_at:387:391; Interrogation_Position=2431; Antisense; GAAACGTGTTACATGCCTTGCATAT
>probe:Drosophila_2:1630839_at:645:457; Interrogation_Position=2495; Antisense; GATATATACACTTAGACACGCAATT

Paste this into a BLAST search page for me
AAGAGGCAACCTCGTAGCTACAACCGTAGCTACAACCAATCTCTTGGCGTAATCTCTTGGCGTTTCCATTGGTATGCGCGCGACTCGGACACGAAAGCAAAGTTAAACTCCCTAGTATTCCGATGTAGTATTCCGATGACCATTCCCTATTCCCTATCCTTGTGGCGTTTGGAAATGCTTTCTAAAAGTGAGACCCCTGAGTGAGACCCCTGAATTGAAATTTAAGTGTGCATTAAACTAAACCAACTCCATGCTGGGAGCGTTCTGATAATGGCGATAATGGCGATTTGTCCGAGCGATGAAACGTGTTACATGCCTTGCATATGATATATACACTTAGACACGCAATT

Full Affymetrix probeset data:

Annotations for 1630839_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720