FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630840_at:

>probe:Drosophila_2:1630840_at:548:689; Interrogation_Position=1976; Antisense; TATTTTAATCACTTTCATTCGCAGC
>probe:Drosophila_2:1630840_at:94:259; Interrogation_Position=2002; Antisense; CACATCGCTTTTGGGATATGCCGGC
>probe:Drosophila_2:1630840_at:620:23; Interrogation_Position=2017; Antisense; ATATGCCGGCTCTATTTCTACAATG
>probe:Drosophila_2:1630840_at:443:185; Interrogation_Position=2059; Antisense; AACAGACCTAACACTTTACTCAGCT
>probe:Drosophila_2:1630840_at:350:337; Interrogation_Position=2081; Antisense; GCTCCAATGGCTGTATCACGTTCAA
>probe:Drosophila_2:1630840_at:192:35; Interrogation_Position=2095; Antisense; ATCACGTTCAAGTACCAGGACTAGA
>probe:Drosophila_2:1630840_at:646:493; Interrogation_Position=2141; Antisense; GTAATTCCACAGTCTGCATCTAGTA
>probe:Drosophila_2:1630840_at:489:561; Interrogation_Position=2197; Antisense; GGAAGACTCGACTGGTCGTTATATA
>probe:Drosophila_2:1630840_at:429:99; Interrogation_Position=2221; Antisense; AGATGAGTATTCTAGTCGTGACTAT
>probe:Drosophila_2:1630840_at:396:87; Interrogation_Position=2275; Antisense; AGTCATTAAACTCTTCGGCTTGGGC
>probe:Drosophila_2:1630840_at:213:717; Interrogation_Position=2288; Antisense; TTCGGCTTGGGCATGCCAAAATATT
>probe:Drosophila_2:1630840_at:219:725; Interrogation_Position=2414; Antisense; TTGAATGGACTCTAGGTATGCCTGT
>probe:Drosophila_2:1630840_at:145:485; Interrogation_Position=2429; Antisense; GTATGCCTGTATAATAAGCTCGGTA
>probe:Drosophila_2:1630840_at:613:647; Interrogation_Position=2486; Antisense; TAAGGCGTCGGAGATGTCAATATTA

Paste this into a BLAST search page for me
TATTTTAATCACTTTCATTCGCAGCCACATCGCTTTTGGGATATGCCGGCATATGCCGGCTCTATTTCTACAATGAACAGACCTAACACTTTACTCAGCTGCTCCAATGGCTGTATCACGTTCAAATCACGTTCAAGTACCAGGACTAGAGTAATTCCACAGTCTGCATCTAGTAGGAAGACTCGACTGGTCGTTATATAAGATGAGTATTCTAGTCGTGACTATAGTCATTAAACTCTTCGGCTTGGGCTTCGGCTTGGGCATGCCAAAATATTTTGAATGGACTCTAGGTATGCCTGTGTATGCCTGTATAATAAGCTCGGTATAAGGCGTCGGAGATGTCAATATTA

Full Affymetrix probeset data:

Annotations for 1630840_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720