FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630841_at:

>probe:Drosophila_2:1630841_at:540:551; Interrogation_Position=2281; Antisense; GGAGACATTGTGCACGAACTCTACG
>probe:Drosophila_2:1630841_at:595:193; Interrogation_Position=2297; Antisense; AACTCTACGTGCGATCTCTGAAGAC
>probe:Drosophila_2:1630841_at:453:411; Interrogation_Position=2319; Antisense; GACCGTTTATCTGAAGCTGGAGGAC
>probe:Drosophila_2:1630841_at:163:555; Interrogation_Position=2340; Antisense; GGACGTGTTCACCACGGGCATAGTA
>probe:Drosophila_2:1630841_at:266:567; Interrogation_Position=2356; Antisense; GGCATAGTAGCCAAGAGCCTTAATG
>probe:Drosophila_2:1630841_at:106:381; Interrogation_Position=2397; Antisense; GAACGAGTTCGTTAACCGACGCATC
>probe:Drosophila_2:1630841_at:11:411; Interrogation_Position=2414; Antisense; GACGCATCTCATTTAACCCGTGCAA
>probe:Drosophila_2:1630841_at:701:261; Interrogation_Position=2454; Antisense; CAGCGTGCACATGATCAAGTCGAAC
>probe:Drosophila_2:1630841_at:88:287; Interrogation_Position=2506; Antisense; CTGGATCAGACCACCAAGTGTAAAT
>probe:Drosophila_2:1630841_at:79:387; Interrogation_Position=2569; Antisense; GAACACAGTGTGGTCTTTCGAGAAA
>probe:Drosophila_2:1630841_at:413:163; Interrogation_Position=2700; Antisense; AAATTCTGTTGTCGATCTCTGCATC
>probe:Drosophila_2:1630841_at:701:43; Interrogation_Position=2722; Antisense; ATCCGCCTATATGCATGCGATCCAA
>probe:Drosophila_2:1630841_at:730:269; Interrogation_Position=2735; Antisense; CATGCGATCCAACAACGATTCGAGT
>probe:Drosophila_2:1630841_at:381:245; Interrogation_Position=2818; Antisense; AATTACTGAGCGATAACTGTGGTTA

Paste this into a BLAST search page for me
GGAGACATTGTGCACGAACTCTACGAACTCTACGTGCGATCTCTGAAGACGACCGTTTATCTGAAGCTGGAGGACGGACGTGTTCACCACGGGCATAGTAGGCATAGTAGCCAAGAGCCTTAATGGAACGAGTTCGTTAACCGACGCATCGACGCATCTCATTTAACCCGTGCAACAGCGTGCACATGATCAAGTCGAACCTGGATCAGACCACCAAGTGTAAATGAACACAGTGTGGTCTTTCGAGAAAAAATTCTGTTGTCGATCTCTGCATCATCCGCCTATATGCATGCGATCCAACATGCGATCCAACAACGATTCGAGTAATTACTGAGCGATAACTGTGGTTA

Full Affymetrix probeset data:

Annotations for 1630841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720