Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630842_s_at:

>probe:Drosophila_2:1630842_s_at:555:363; Interrogation_Position=117; Antisense; GAATAAACATCCACGAACGACGGCT
>probe:Drosophila_2:1630842_s_at:226:383; Interrogation_Position=131; Antisense; GAACGACGGCTCAATTCCGGAAGAT
>probe:Drosophila_2:1630842_s_at:665:709; Interrogation_Position=167; Antisense; TTAATGTCCTGTCAGATGCGTCGGC
>probe:Drosophila_2:1630842_s_at:138:549; Interrogation_Position=194; Antisense; GGAGGAAATACGATGCATCCGTTAT
>probe:Drosophila_2:1630842_s_at:609:267; Interrogation_Position=209; Antisense; CATCCGTTATGCTTAGTAGGCGTGC
>probe:Drosophila_2:1630842_s_at:463:403; Interrogation_Position=22; Antisense; GACTACTATATGATCCTGGGCGTGG
>probe:Drosophila_2:1630842_s_at:359:485; Interrogation_Position=224; Antisense; GTAGGCGTGCGCATACAACGAATAA
>probe:Drosophila_2:1630842_s_at:629:127; Interrogation_Position=269; Antisense; ACCAGCCAAACGGATCCTACGAAAG
>probe:Drosophila_2:1630842_s_at:138:59; Interrogation_Position=31; Antisense; ATGATCCTGGGCGTGGACCACAACG
>probe:Drosophila_2:1630842_s_at:432:397; Interrogation_Position=310; Antisense; GACACATTTTCCACTGTGTGTGCCG
>probe:Drosophila_2:1630842_s_at:494:591; Interrogation_Position=350; Antisense; TGGGTCTTTTTCTTGGATTCGGAGC
>probe:Drosophila_2:1630842_s_at:350:543; Interrogation_Position=364; Antisense; GGATTCGGAGCTTTCAAGGCATTAA
>probe:Drosophila_2:1630842_s_at:697:159; Interrogation_Position=50; Antisense; ACAACGCCACCGACGAGGAAATCAG
>probe:Drosophila_2:1630842_s_at:140:567; Interrogation_Position=93; Antisense; GGCACTCATTTACCATCCGGATAAG

Paste this into a BLAST search page for me
GAATAAACATCCACGAACGACGGCTGAACGACGGCTCAATTCCGGAAGATTTAATGTCCTGTCAGATGCGTCGGCGGAGGAAATACGATGCATCCGTTATCATCCGTTATGCTTAGTAGGCGTGCGACTACTATATGATCCTGGGCGTGGGTAGGCGTGCGCATACAACGAATAAACCAGCCAAACGGATCCTACGAAAGATGATCCTGGGCGTGGACCACAACGGACACATTTTCCACTGTGTGTGCCGTGGGTCTTTTTCTTGGATTCGGAGCGGATTCGGAGCTTTCAAGGCATTAAACAACGCCACCGACGAGGAAATCAGGGCACTCATTTACCATCCGGATAAG

Full Affymetrix probeset data:

Annotations for 1630842_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime