FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630844_at:

>probe:Drosophila_2:1630844_at:535:223; Interrogation_Position=1022; Antisense; AAGGATCTCAGCAGCAGAGGCCGAC
>probe:Drosophila_2:1630844_at:545:69; Interrogation_Position=1039; Antisense; AGGCCGACCAAGTAAATAGCTCATT
>probe:Drosophila_2:1630844_at:114:241; Interrogation_Position=1127; Antisense; AATAAGCTTATCAGCCTGGGCTAAA
>probe:Drosophila_2:1630844_at:557:191; Interrogation_Position=576; Antisense; AACTTATAGCGGCATTCTGGTCCCA
>probe:Drosophila_2:1630844_at:255:583; Interrogation_Position=593; Antisense; TGGTCCCAGGCAGTAATGTATTCAA
>probe:Drosophila_2:1630844_at:471:425; Interrogation_Position=641; Antisense; GAGAGCCTGGTCCAATTAACACAGA
>probe:Drosophila_2:1630844_at:312:105; Interrogation_Position=663; Antisense; AGACTCAAACCATCCAGCCGAGAAT
>probe:Drosophila_2:1630844_at:116:423; Interrogation_Position=682; Antisense; GAGAATCCTAACACCTCAGTCTTTT
>probe:Drosophila_2:1630844_at:513:717; Interrogation_Position=717; Antisense; TTCCCCATCTACTGGACCTATTGAT
>probe:Drosophila_2:1630844_at:447:57; Interrogation_Position=749; Antisense; ATGTATATAATTCCCGACCAAGCCA
>probe:Drosophila_2:1630844_at:382:81; Interrogation_Position=775; Antisense; AGGGAACCCGTCTTTGTGCCAGTGA
>probe:Drosophila_2:1630844_at:676:505; Interrogation_Position=790; Antisense; GTGCCAGTGATTGACTCAACCACCA
>probe:Drosophila_2:1630844_at:264:91; Interrogation_Position=828; Antisense; AGTTCCCCGGTTCAGTTCAGCATTA
>probe:Drosophila_2:1630844_at:5:313; Interrogation_Position=985; Antisense; GCCAGATTTGTTCTAAGCTCAGTCA

Paste this into a BLAST search page for me
AAGGATCTCAGCAGCAGAGGCCGACAGGCCGACCAAGTAAATAGCTCATTAATAAGCTTATCAGCCTGGGCTAAAAACTTATAGCGGCATTCTGGTCCCATGGTCCCAGGCAGTAATGTATTCAAGAGAGCCTGGTCCAATTAACACAGAAGACTCAAACCATCCAGCCGAGAATGAGAATCCTAACACCTCAGTCTTTTTTCCCCATCTACTGGACCTATTGATATGTATATAATTCCCGACCAAGCCAAGGGAACCCGTCTTTGTGCCAGTGAGTGCCAGTGATTGACTCAACCACCAAGTTCCCCGGTTCAGTTCAGCATTAGCCAGATTTGTTCTAAGCTCAGTCA

Full Affymetrix probeset data:

Annotations for 1630844_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720