FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630845_at:

>probe:Drosophila_2:1630845_at:368:561; Interrogation_Position=154; Antisense; GGCACGGTTTTCTTCGAACAGGAGA
>probe:Drosophila_2:1630845_at:37:581; Interrogation_Position=221; Antisense; TGGCCAAGGGTCTGCACGGATTCCA
>probe:Drosophila_2:1630845_at:455:461; Interrogation_Position=239; Antisense; GATTCCACGTGCACGAGTTCGGTGA
>probe:Drosophila_2:1630845_at:154:189; Interrogation_Position=265; Antisense; AACACCAATGGCTGCATGTCGTCCG
>probe:Drosophila_2:1630845_at:143:413; Interrogation_Position=290; Antisense; GACCGCACTTCAATCCGTATGGCAA
>probe:Drosophila_2:1630845_at:227:409; Interrogation_Position=334; Antisense; GACGAGAATCGTCACCTGGGCGATC
>probe:Drosophila_2:1630845_at:499:37; Interrogation_Position=482; Antisense; ATCTTGGCCAGGGTGGACACGAGCT
>probe:Drosophila_2:1630845_at:283:535; Interrogation_Position=542; Antisense; GGTGCGGCGTTATTGGCATTGCCAA
>probe:Drosophila_2:1630845_at:387:345; Interrogation_Position=557; Antisense; GCATTGCCAAGGTCTAAGCGATAAT
>probe:Drosophila_2:1630845_at:717:655; Interrogation_Position=578; Antisense; TAATCTATTCCGATGTCGGCCACTG
>probe:Drosophila_2:1630845_at:193:309; Interrogation_Position=597; Antisense; CCACTGTGCTGATCTACTCTATTTA
>probe:Drosophila_2:1630845_at:391:689; Interrogation_Position=616; Antisense; TATTTAGCACTACCCACTGGAGATA
>probe:Drosophila_2:1630845_at:501:271; Interrogation_Position=674; Antisense; CATAGCCTGTGGTCTGTTAGTTGAT
>probe:Drosophila_2:1630845_at:355:591; Interrogation_Position=724; Antisense; TGGTGTTTTGAAATTGCCCCATAAA

Paste this into a BLAST search page for me
GGCACGGTTTTCTTCGAACAGGAGATGGCCAAGGGTCTGCACGGATTCCAGATTCCACGTGCACGAGTTCGGTGAAACACCAATGGCTGCATGTCGTCCGGACCGCACTTCAATCCGTATGGCAAGACGAGAATCGTCACCTGGGCGATCATCTTGGCCAGGGTGGACACGAGCTGGTGCGGCGTTATTGGCATTGCCAAGCATTGCCAAGGTCTAAGCGATAATTAATCTATTCCGATGTCGGCCACTGCCACTGTGCTGATCTACTCTATTTATATTTAGCACTACCCACTGGAGATACATAGCCTGTGGTCTGTTAGTTGATTGGTGTTTTGAAATTGCCCCATAAA

Full Affymetrix probeset data:

Annotations for 1630845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720