FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630846_at:

>probe:Drosophila_2:1630846_at:88:611; Interrogation_Position=1597; Antisense; TGACCAGCATTTCAAGTTCCCGGTT
>probe:Drosophila_2:1630846_at:599:73; Interrogation_Position=1644; Antisense; AGGAACTGATCCTCCAAGTGCTCGA
>probe:Drosophila_2:1630846_at:319:669; Interrogation_Position=1670; Antisense; TACGATCGCTATTCGCACAACGACA
>probe:Drosophila_2:1630846_at:404:717; Interrogation_Position=1707; Antisense; TTCGCATCTCTGTGGATGGCCTAGA
>probe:Drosophila_2:1630846_at:403:69; Interrogation_Position=1722; Antisense; ATGGCCTAGATCTCTCCAAGTCAGT
>probe:Drosophila_2:1630846_at:43:437; Interrogation_Position=1787; Antisense; GAGGATCGACCGGAACTGCTGTGCT
>probe:Drosophila_2:1630846_at:127:145; Interrogation_Position=1801; Antisense; ACTGCTGTGCTCCTTGAACTATTTG
>probe:Drosophila_2:1630846_at:677:191; Interrogation_Position=1817; Antisense; AACTATTTGCCGCAGGCCGAGCGAT
>probe:Drosophila_2:1630846_at:369:709; Interrogation_Position=1950; Antisense; TTACAAAGTCGGACGATCCCACCAA
>probe:Drosophila_2:1630846_at:144:437; Interrogation_Position=1988; Antisense; GAGGCGTTCACGTTTAATTTGCAAT
>probe:Drosophila_2:1630846_at:194:703; Interrogation_Position=2017; Antisense; TTATCTTCACAATGCAGCCATCGAG
>probe:Drosophila_2:1630846_at:81:165; Interrogation_Position=2076; Antisense; AAATCGGATGCTGCGGACTGGGCCC
>probe:Drosophila_2:1630846_at:457:313; Interrogation_Position=2121; Antisense; GCCAGCACTGGCACGATATGATTAA
>probe:Drosophila_2:1630846_at:653:175; Interrogation_Position=2156; Antisense; AAACCTACGGCTATGTGGCACTATA

Paste this into a BLAST search page for me
TGACCAGCATTTCAAGTTCCCGGTTAGGAACTGATCCTCCAAGTGCTCGATACGATCGCTATTCGCACAACGACATTCGCATCTCTGTGGATGGCCTAGAATGGCCTAGATCTCTCCAAGTCAGTGAGGATCGACCGGAACTGCTGTGCTACTGCTGTGCTCCTTGAACTATTTGAACTATTTGCCGCAGGCCGAGCGATTTACAAAGTCGGACGATCCCACCAAGAGGCGTTCACGTTTAATTTGCAATTTATCTTCACAATGCAGCCATCGAGAAATCGGATGCTGCGGACTGGGCCCGCCAGCACTGGCACGATATGATTAAAAACCTACGGCTATGTGGCACTATA

Full Affymetrix probeset data:

Annotations for 1630846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720