FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630847_at:

>probe:Drosophila_2:1630847_at:523:17; Interrogation_Position=1059; Antisense; ATTTCGCGGCAAAATGTCGCACGTA
>probe:Drosophila_2:1630847_at:201:185; Interrogation_Position=1109; Antisense; AAAATGGTATCACCGCATTCCAGCG
>probe:Drosophila_2:1630847_at:163:481; Interrogation_Position=1150; Antisense; GTATTGTATGCCCATGTCGGCGAAC
>probe:Drosophila_2:1630847_at:14:267; Interrogation_Position=1186; Antisense; CAGGGTATATTCTCTATGCGGCTAT
>probe:Drosophila_2:1630847_at:250:55; Interrogation_Position=1217; Antisense; ATGAAACTTTTGTGCCCACCATCAA
>probe:Drosophila_2:1630847_at:156:217; Interrogation_Position=1264; Antisense; AAGTTGGAGTCCTGTTGCTATGCGC
>probe:Drosophila_2:1630847_at:163:195; Interrogation_Position=1292; Antisense; AACTGCAGCCTTTTGGGATGGTCGA
>probe:Drosophila_2:1630847_at:173:65; Interrogation_Position=1309; Antisense; ATGGTCGAGCCGCTAATTATGCCGC
>probe:Drosophila_2:1630847_at:302:607; Interrogation_Position=1365; Antisense; TGATGATTTCGCATTCGTTCCATAG
>probe:Drosophila_2:1630847_at:21:197; Interrogation_Position=811; Antisense; AACTGGTTCTATCGCCATACGACGA
>probe:Drosophila_2:1630847_at:120:319; Interrogation_Position=850; Antisense; GCCGAGTTGCCTAGCTATTTCTATA
>probe:Drosophila_2:1630847_at:30:215; Interrogation_Position=875; Antisense; AAGAGGGCTACATATGCGCCGCCTA
>probe:Drosophila_2:1630847_at:49:467; Interrogation_Position=945; Antisense; GTTGGACGCCCAATGTGTGAACATA
>probe:Drosophila_2:1630847_at:106:101; Interrogation_Position=969; Antisense; AGAGTATGTGGATCATGCCCTGTCT

Paste this into a BLAST search page for me
ATTTCGCGGCAAAATGTCGCACGTAAAAATGGTATCACCGCATTCCAGCGGTATTGTATGCCCATGTCGGCGAACCAGGGTATATTCTCTATGCGGCTATATGAAACTTTTGTGCCCACCATCAAAAGTTGGAGTCCTGTTGCTATGCGCAACTGCAGCCTTTTGGGATGGTCGAATGGTCGAGCCGCTAATTATGCCGCTGATGATTTCGCATTCGTTCCATAGAACTGGTTCTATCGCCATACGACGAGCCGAGTTGCCTAGCTATTTCTATAAAGAGGGCTACATATGCGCCGCCTAGTTGGACGCCCAATGTGTGAACATAAGAGTATGTGGATCATGCCCTGTCT

Full Affymetrix probeset data:

Annotations for 1630847_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720