FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630848_at:

>probe:Drosophila_2:1630848_at:512:119; Interrogation_Position=114; Antisense; AGCTGCTGAATCCTGTCCAGATGAT
>probe:Drosophila_2:1630848_at:166:391; Interrogation_Position=151; Antisense; GAAACTATCCAAGCCTGCGTATCTA
>probe:Drosophila_2:1630848_at:64:623; Interrogation_Position=166; Antisense; TGCGTATCTACAGACACTACCAGCT
>probe:Drosophila_2:1630848_at:607:565; Interrogation_Position=208; Antisense; GGCAAATGTCCGATGGCCACAGAAA
>probe:Drosophila_2:1630848_at:658:187; Interrogation_Position=373; Antisense; AACAGCACGGCAAGCGATGTCTTCT
>probe:Drosophila_2:1630848_at:724:569; Interrogation_Position=419; Antisense; GGCATCTTAACTACTGTCCAACGGG
>probe:Drosophila_2:1630848_at:369:195; Interrogation_Position=438; Antisense; AACGGGCTTTACCTTTGATGACGAG
>probe:Drosophila_2:1630848_at:549:409; Interrogation_Position=457; Antisense; GACGAGCTGCAGATTTGCCTGAACA
>probe:Drosophila_2:1630848_at:383:545; Interrogation_Position=484; Antisense; GGATCTGATGACGACGAGTTGCCCA
>probe:Drosophila_2:1630848_at:712:427; Interrogation_Position=499; Antisense; GAGTTGCCCAGTTCGTCTGGAAAGT
>probe:Drosophila_2:1630848_at:562:463; Interrogation_Position=536; Antisense; GATTGTTTGGTGATCCCGCTGACTG
>probe:Drosophila_2:1630848_at:340:335; Interrogation_Position=553; Antisense; GCTGACTGCTCTGGGTACTATCATT
>probe:Drosophila_2:1630848_at:142:447; Interrogation_Position=611; Antisense; GATGCTCGGTAGGAACCATCTTCAA
>probe:Drosophila_2:1630848_at:187:39; Interrogation_Position=635; Antisense; ATCTAATTTCCTTTGCGTGCGTTAC

Paste this into a BLAST search page for me
AGCTGCTGAATCCTGTCCAGATGATGAAACTATCCAAGCCTGCGTATCTATGCGTATCTACAGACACTACCAGCTGGCAAATGTCCGATGGCCACAGAAAAACAGCACGGCAAGCGATGTCTTCTGGCATCTTAACTACTGTCCAACGGGAACGGGCTTTACCTTTGATGACGAGGACGAGCTGCAGATTTGCCTGAACAGGATCTGATGACGACGAGTTGCCCAGAGTTGCCCAGTTCGTCTGGAAAGTGATTGTTTGGTGATCCCGCTGACTGGCTGACTGCTCTGGGTACTATCATTGATGCTCGGTAGGAACCATCTTCAAATCTAATTTCCTTTGCGTGCGTTAC

Full Affymetrix probeset data:

Annotations for 1630848_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720