FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630850_at:

>probe:Drosophila_2:1630850_at:77:243; Interrogation_Position=1243; Antisense; AATATGCCGGAGTGCTATGAGCTGC
>probe:Drosophila_2:1630850_at:204:305; Interrogation_Position=1274; Antisense; CCTTCAACCTGAGCTACAACTATGT
>probe:Drosophila_2:1630850_at:442:331; Interrogation_Position=1327; Antisense; GCGGAACAGCAGACGCTCTTCAAGG
>probe:Drosophila_2:1630850_at:427:643; Interrogation_Position=1343; Antisense; TCTTCAAGGAGCCAGTCTTCTACTT
>probe:Drosophila_2:1630850_at:169:83; Interrogation_Position=1372; Antisense; AGGGACTTGTGCTTCTCTAGACTGA
>probe:Drosophila_2:1630850_at:217:677; Interrogation_Position=1389; Antisense; TAGACTGATCTTCTTGTCGGTTCCT
>probe:Drosophila_2:1630850_at:356:315; Interrogation_Position=1428; Antisense; GCCATATCGTCATCTCTTCGATGAA
>probe:Drosophila_2:1630850_at:74:607; Interrogation_Position=1457; Antisense; TGATGCAGCAGCACGAATTCGGCTT
>probe:Drosophila_2:1630850_at:299:241; Interrogation_Position=1472; Antisense; AATTCGGCTTTGTGAACTACTGGAT
>probe:Drosophila_2:1630850_at:443:547; Interrogation_Position=1493; Antisense; GGATGAGCCACAGCTTTTTCGATAT
>probe:Drosophila_2:1630850_at:720:423; Interrogation_Position=1521; Antisense; GAGACTTGGTCTAACATCACTTAAG
>probe:Drosophila_2:1630850_at:282:679; Interrogation_Position=1554; Antisense; TAGGCCATTAGCGTATACTCCAAGC
>probe:Drosophila_2:1630850_at:56:689; Interrogation_Position=1615; Antisense; TATTTGGCTGCCATAGTGCTTTGCG
>probe:Drosophila_2:1630850_at:128:87; Interrogation_Position=1629; Antisense; AGTGCTTTGCGTTTTCTGCTTCTTA

Paste this into a BLAST search page for me
AATATGCCGGAGTGCTATGAGCTGCCCTTCAACCTGAGCTACAACTATGTGCGGAACAGCAGACGCTCTTCAAGGTCTTCAAGGAGCCAGTCTTCTACTTAGGGACTTGTGCTTCTCTAGACTGATAGACTGATCTTCTTGTCGGTTCCTGCCATATCGTCATCTCTTCGATGAATGATGCAGCAGCACGAATTCGGCTTAATTCGGCTTTGTGAACTACTGGATGGATGAGCCACAGCTTTTTCGATATGAGACTTGGTCTAACATCACTTAAGTAGGCCATTAGCGTATACTCCAAGCTATTTGGCTGCCATAGTGCTTTGCGAGTGCTTTGCGTTTTCTGCTTCTTA

Full Affymetrix probeset data:

Annotations for 1630850_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720