Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630851_s_at:

>probe:Drosophila_2:1630851_s_at:203:157; Interrogation_Position=1011; Antisense; ACACTGTGGGCGTGTGCAGCGTCAA
>probe:Drosophila_2:1630851_s_at:574:543; Interrogation_Position=1100; Antisense; GGATACTAGAGCCTCCGATTCTGAA
>probe:Drosophila_2:1630851_s_at:354:187; Interrogation_Position=1127; Antisense; AACTTAGTTTAGGTCTAGCTCGGCG
>probe:Drosophila_2:1630851_s_at:53:279; Interrogation_Position=1141; Antisense; CTAGCTCGGCGGTTTTGCATTAAAA
>probe:Drosophila_2:1630851_s_at:628:437; Interrogation_Position=665; Antisense; GAGGACCAGTGCTGCGACGACAACA
>probe:Drosophila_2:1630851_s_at:715:189; Interrogation_Position=686; Antisense; AACATCGAGATGAAGCCCAAGTCCT
>probe:Drosophila_2:1630851_s_at:50:467; Interrogation_Position=717; Antisense; GTTGGATGACCCGTGTGCTCTACAA
>probe:Drosophila_2:1630851_s_at:604:643; Interrogation_Position=735; Antisense; TCTACAACCGTCGTTCGCGGATGAA
>probe:Drosophila_2:1630851_s_at:333:39; Interrogation_Position=828; Antisense; ATCTCCGTGGACGATCCTACGAGGA
>probe:Drosophila_2:1630851_s_at:632:303; Interrogation_Position=888; Antisense; CCGTTCCGCTGGTCCGTGAGAAGAA
>probe:Drosophila_2:1630851_s_at:609:397; Interrogation_Position=920; Antisense; GACAGGGACTTTACCGCCGTAGAAG
>probe:Drosophila_2:1630851_s_at:88:487; Interrogation_Position=938; Antisense; GTAGAAGCTTCCGAACTGATCCGCA
>probe:Drosophila_2:1630851_s_at:97:67; Interrogation_Position=968; Antisense; ATGGAGGTGCTTTACTACCGCGATA
>probe:Drosophila_2:1630851_s_at:300:327; Interrogation_Position=987; Antisense; GCGATACTCGTAATATTTCCCAATA

Paste this into a BLAST search page for me
ACACTGTGGGCGTGTGCAGCGTCAAGGATACTAGAGCCTCCGATTCTGAAAACTTAGTTTAGGTCTAGCTCGGCGCTAGCTCGGCGGTTTTGCATTAAAAGAGGACCAGTGCTGCGACGACAACAAACATCGAGATGAAGCCCAAGTCCTGTTGGATGACCCGTGTGCTCTACAATCTACAACCGTCGTTCGCGGATGAAATCTCCGTGGACGATCCTACGAGGACCGTTCCGCTGGTCCGTGAGAAGAAGACAGGGACTTTACCGCCGTAGAAGGTAGAAGCTTCCGAACTGATCCGCAATGGAGGTGCTTTACTACCGCGATAGCGATACTCGTAATATTTCCCAATA

Full Affymetrix probeset data:

Annotations for 1630851_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime