Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630852_at:

>probe:Drosophila_2:1630852_at:318:705; Interrogation_Position=1064; Antisense; TTATGCTCAACTTTCTACCGCTGGT
>probe:Drosophila_2:1630852_at:367:619; Interrogation_Position=1088; Antisense; TGCTCAATATATCCGAGGCCTTCTA
>probe:Drosophila_2:1630852_at:68:307; Interrogation_Position=1106; Antisense; CCTTCTATAGCACCATCGATCATAA
>probe:Drosophila_2:1630852_at:116:697; Interrogation_Position=1180; Antisense; TTTCTCATTTACATCATCTTCGGCG
>probe:Drosophila_2:1630852_at:646:607; Interrogation_Position=1250; Antisense; TGAGTCGTGACCAACCGGATCTTAT
>probe:Drosophila_2:1630852_at:606:451; Interrogation_Position=1267; Antisense; GATCTTATCCACTACGAGAGCTCCA
>probe:Drosophila_2:1630852_at:226:421; Interrogation_Position=1282; Antisense; GAGAGCTCCATATCGAACAACGGCG
>probe:Drosophila_2:1630852_at:390:575; Interrogation_Position=1303; Antisense; GGCGATGGAACTCTGAACCACCGAT
>probe:Drosophila_2:1630852_at:17:331; Interrogation_Position=1424; Antisense; GCGGTGGCAATAATTCCCTCAATAA
>probe:Drosophila_2:1630852_at:376:183; Interrogation_Position=1444; Antisense; AATAATGTCCGACTGACCCAGGTCT
>probe:Drosophila_2:1630852_at:402:453; Interrogation_Position=1472; Antisense; GATCACCCGGTCTGGTCAAGATCAA
>probe:Drosophila_2:1630852_at:324:455; Interrogation_Position=1491; Antisense; GATCAAGCGAAATCGAGCTCCCTCG
>probe:Drosophila_2:1630852_at:554:151; Interrogation_Position=1592; Antisense; ACACTTCTATTGGTTACGACTGGAC
>probe:Drosophila_2:1630852_at:486:159; Interrogation_Position=1630; Antisense; AAAAAACTGGGACACGTCTCCTCTG

Paste this into a BLAST search page for me
TTATGCTCAACTTTCTACCGCTGGTTGCTCAATATATCCGAGGCCTTCTACCTTCTATAGCACCATCGATCATAATTTCTCATTTACATCATCTTCGGCGTGAGTCGTGACCAACCGGATCTTATGATCTTATCCACTACGAGAGCTCCAGAGAGCTCCATATCGAACAACGGCGGGCGATGGAACTCTGAACCACCGATGCGGTGGCAATAATTCCCTCAATAAAATAATGTCCGACTGACCCAGGTCTGATCACCCGGTCTGGTCAAGATCAAGATCAAGCGAAATCGAGCTCCCTCGACACTTCTATTGGTTACGACTGGACAAAAAACTGGGACACGTCTCCTCTG

Full Affymetrix probeset data:

Annotations for 1630852_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime