FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630853_at:

>probe:Drosophila_2:1630853_at:718:549; Interrogation_Position=1034; Antisense; GGAGATTCGCAGAGCCACGGGAAAT
>probe:Drosophila_2:1630853_at:306:457; Interrogation_Position=1080; Antisense; GATAGAACACCTTTCGCTGGAGCTG
>probe:Drosophila_2:1630853_at:11:201; Interrogation_Position=1115; Antisense; AACCGCCCATGCTGTGTGGACTTTT
>probe:Drosophila_2:1630853_at:223:557; Interrogation_Position=1132; Antisense; GGACTTTTGCACCTGGATCGTCGAT
>probe:Drosophila_2:1630853_at:13:467; Interrogation_Position=1154; Antisense; GATTGGTGTACCTGATTGCTGTCAC
>probe:Drosophila_2:1630853_at:81:721; Interrogation_Position=1185; Antisense; TTCCTACTTCATAACTCTGGTGCAG
>probe:Drosophila_2:1630853_at:543:509; Interrogation_Position=1204; Antisense; GTGCAGTTCGATCTCTATTTGCGCA
>probe:Drosophila_2:1630853_at:611:249; Interrogation_Position=657; Antisense; CAATCTTCAGTTGGGATCGCTCAGG
>probe:Drosophila_2:1630853_at:358:451; Interrogation_Position=784; Antisense; GATCTGCAGCGCGAGAGCTTTCGGA
>probe:Drosophila_2:1630853_at:368:419; Interrogation_Position=798; Antisense; GAGCTTTCGGATGCATCAGTTCCAG
>probe:Drosophila_2:1630853_at:275:93; Interrogation_Position=815; Antisense; AGTTCCAGCTGATCGGACTCATGCT
>probe:Drosophila_2:1630853_at:570:607; Interrogation_Position=839; Antisense; TGAGCACGCTCATCAACAACTTGAC
>probe:Drosophila_2:1630853_at:127:153; Interrogation_Position=884; Antisense; ACATGCTGGCCAAACAGTCGCTAGA
>probe:Drosophila_2:1630853_at:210:673; Interrogation_Position=943; Antisense; TACGCCACTGGGTTCTACATAGACA

Paste this into a BLAST search page for me
GGAGATTCGCAGAGCCACGGGAAATGATAGAACACCTTTCGCTGGAGCTGAACCGCCCATGCTGTGTGGACTTTTGGACTTTTGCACCTGGATCGTCGATGATTGGTGTACCTGATTGCTGTCACTTCCTACTTCATAACTCTGGTGCAGGTGCAGTTCGATCTCTATTTGCGCACAATCTTCAGTTGGGATCGCTCAGGGATCTGCAGCGCGAGAGCTTTCGGAGAGCTTTCGGATGCATCAGTTCCAGAGTTCCAGCTGATCGGACTCATGCTTGAGCACGCTCATCAACAACTTGACACATGCTGGCCAAACAGTCGCTAGATACGCCACTGGGTTCTACATAGACA

Full Affymetrix probeset data:

Annotations for 1630853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720