FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630856_at:

>probe:Drosophila_2:1630856_at:265:537; Interrogation_Position=9185; Antisense; GGTCAAGTGAGCGATCGGGATCCCC
>probe:Drosophila_2:1630856_at:714:541; Interrogation_Position=9202; Antisense; GGATCCCCGACATCTTGACGGTTGG
>probe:Drosophila_2:1630856_at:416:227; Interrogation_Position=9246; Antisense; AAGGCCAACGGCTTTCTTGATCGAA
>probe:Drosophila_2:1630856_at:693:83; Interrogation_Position=9280; Antisense; AGTGGACAGTTTACTCACCATTGTT
>probe:Drosophila_2:1630856_at:721:213; Interrogation_Position=9329; Antisense; AAGTTCGTTGGATTTGCTTTGGCAA
>probe:Drosophila_2:1630856_at:580:203; Interrogation_Position=9352; Antisense; AAGCTCTTGTCGCAAGACGCTCAAG
>probe:Drosophila_2:1630856_at:499:61; Interrogation_Position=9384; Antisense; ATGTCGAACTGCAGATGGGCCCGCA
>probe:Drosophila_2:1630856_at:728:585; Interrogation_Position=9399; Antisense; TGGGCCCGCACTTTTATACCAAAAG
>probe:Drosophila_2:1630856_at:700:51; Interrogation_Position=9426; Antisense; ATGCTTAACTTGGTCTGGCCCATTA
>probe:Drosophila_2:1630856_at:634:13; Interrogation_Position=9450; Antisense; ATTATTGCTGGATATCCGTCTTCGC
>probe:Drosophila_2:1630856_at:571:305; Interrogation_Position=9489; Antisense; CCTGGCGCTTCTTCTAGTCGAAGAA
>probe:Drosophila_2:1630856_at:237:417; Interrogation_Position=9534; Antisense; GAGCGGAGCAGTGATCATTAACCCA
>probe:Drosophila_2:1630856_at:110:453; Interrogation_Position=9546; Antisense; GATCATTAACCCAGAGGCGGCTGTT
>probe:Drosophila_2:1630856_at:89:687; Interrogation_Position=9605; Antisense; TATTTTTCCCTTTGATCTTACGTAT

Paste this into a BLAST search page for me
GGTCAAGTGAGCGATCGGGATCCCCGGATCCCCGACATCTTGACGGTTGGAAGGCCAACGGCTTTCTTGATCGAAAGTGGACAGTTTACTCACCATTGTTAAGTTCGTTGGATTTGCTTTGGCAAAAGCTCTTGTCGCAAGACGCTCAAGATGTCGAACTGCAGATGGGCCCGCATGGGCCCGCACTTTTATACCAAAAGATGCTTAACTTGGTCTGGCCCATTAATTATTGCTGGATATCCGTCTTCGCCCTGGCGCTTCTTCTAGTCGAAGAAGAGCGGAGCAGTGATCATTAACCCAGATCATTAACCCAGAGGCGGCTGTTTATTTTTCCCTTTGATCTTACGTAT

Full Affymetrix probeset data:

Annotations for 1630856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720